| Version: | 3.2.3 |
| Depends: | R (≥ 3.2.0), R.utils (≥ 2.9.0), aroma.core (≥ 3.2.0) |
| Imports: | methods, R.methodsS3 (≥ 1.7.1), R.oo (≥ 1.23.0), R.cache (≥ 0.14.0), R.devices (≥ 2.16.1), R.filesets (≥ 2.13.0), aroma.apd (≥ 0.6.0), MASS, splines, matrixStats (≥ 0.55.0), listenv, future |
| Suggests: | DBI (≥ 1.0.0), RColorBrewer (≥ 1.1-2), Biobase (≥ 2.28.0), BiocGenerics (≥ 0.14.0), affxparser (≥ 1.40.0), affy (≥ 1.46.0), affyPLM (≥ 1.44.0), aroma.light (≥ 2.4.0), gcrma (≥ 2.40.0), limma (≥ 3.24.1), oligo (≥ 1.32.0), oligoClasses (≥ 1.30.0), pdInfoBuilder (≥ 1.32.0), preprocessCore (≥ 1.28.0), AffymetrixDataTestFiles, dChipIO (≥ 0.1.1) |
| SuggestsNote: | BioC (>= 3.0), Recommended: preprocessCore, affyPLM, aroma.light, affxparser, DNAcopy |
| Title: | Analysis of Large Affymetrix Microarray Data Sets |
| Description: | A cross-platform R framework that facilitates processing of any number of Affymetrix microarray samples regardless of computer system. The only parameter that limits the number of chips that can be processed is the amount of available disk space. The Aroma Framework has successfully been used in studies to process tens of thousands of arrays. This package has actively been used since 2006. |
| License: | LGPL-2.1 | LGPL-3 [expanded from: LGPL (≥ 2.1)] |
| URL: | https://www.aroma-project.org/, https://github.com/HenrikBengtsson/aroma.affymetrix |
| BugReports: | https://github.com/HenrikBengtsson/aroma.affymetrix/issues |
| LazyLoad: | TRUE |
| biocViews: | Infrastructure, ProprietaryPlatforms, ExonArray, Microarray, OneChannel, GUI, DataImport, DataRepresentation, Preprocessing, QualityControl, Visualization, ReportWriting, aCGH, CopyNumberVariants, DifferentialExpression, GeneExpression, SNP, Transcription |
| NeedsCompilation: | no |
| Packaged: | 2025-08-19 03:09:09 UTC; hb |
| Author: | Henrik Bengtsson [aut, cre, cph], James Bullard [ctb], Kasper Hansen [ctb], Pierre Neuvial [ctb], Elizabeth Purdom [ctb], Mark Robinson [ctb], Ken Simpson [ctb] |
| Maintainer: | Henrik Bengtsson <henrikb@braju.com> |
| Repository: | CRAN |
| Date/Publication: | 2025-08-19 07:00:02 UTC |
Package aroma.affymetrix
Description
A cross-platform R framework that facilitates processing of any number of Affymetrix microarray samples regardless of computer system. The only parameter that limits the number of chips that can be processed is the amount of available disk space. The Aroma Framework has successfully been used in studies to process tens of thousands of arrays. This package has actively been used since 2006.
Installation and updates
The preferred way to install this package is:
source("https://callr.org/install#aroma.affymetrix")
To get started
To get started, see the online user guides and the vignettes https://www.aroma-project.org/.
How to cite this package
In order to keep improving and providing support for this project, please cite references [1], [2], or any applicable publication listed on https://aroma-project.org/publications/, whenever you publish work that have been used any of the Aroma Framework.
License
The releases of this package is licensed under LGPL version 2.1 or newer.
The development code of the packages is under a private license (where applicable) and patches sent to the author fall under the latter license, but will be, if incorporated, released under the "release" license above.
Author(s)
Henrik Bengtsson, James Bullard, Kasper Hansen, Pierre Neuvial, Elizabeth Purdom, Mark Robinson, Ken Simpson
References
[1] H. Bengtsson, K. Simpson, J. Bullard, and K. Hansen, aroma.affymetrix: A generic framework in R for analyzing small to very large Affymetrix data sets in bounded memory, Tech Report #745, Department of Statistics, University of California, Berkeley, February 2008.
[2] H. Bengtsson, R. Irizarry, B. Carvalho, and T. Speed, Estimation and assessment of raw copy numbers at the single locus level, Bioinformatics, 2008.
[3] H. Bengtsson, The R.oo package - Object-Oriented Programming with References Using Standard R Code, In Kurt Hornik, Friedrich Leisch and Achim Zeileis, editors, Proceedings of the 3rd International Workshop on Distributed Statistical Computing (DSC 2003), March 20-22, Vienna, Austria. https://www.r-project.org/conferences/DSC-2003/Proceedings/
For a complete list, see https://aroma-project.org/publications/.
The AbstractProbeSequenceNormalization class
Description
Package: aroma.affymetrix
Class AbstractProbeSequenceNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AbstractProbeSequenceNormalization
Directly known subclasses:
BaseCountNormalization, BasePositionNormalization, LinearModelProbeSequenceNormalization, MatNormalization
public abstract static class AbstractProbeSequenceNormalization
extends ProbeLevelTransform3
This abstract class represents a normalization method that corrects for systematic effects in the probe intensities due to differences in probe sequences.
Usage
AbstractProbeSequenceNormalization(..., target=NULL)
Arguments
... |
Arguments passed to the constructor of
|
target |
A |
Fields and Methods
Methods:
getTargetFile | - | |
process | Normalizes the data set. |
Methods inherited from ProbeLevelTransform3:
getAsteriskTags, getCellsTo, getCellsToFit, getCellsToUpdate, getParameters, getUnitsTo, getUnitsToFit, getUnitsToUpdate, writeSignals
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Requirements
This class requires that an AromaCellSequenceFile is
available for the chip type.
Author(s)
Henrik Bengtsson
The AdditiveCovariatesNormalization class
Description
Package: aroma.affymetrix
Class AdditiveCovariatesNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AdditiveCovariatesNormalization
Directly known subclasses:
GcContentNormalization2
public abstract static class AdditiveCovariatesNormalization
extends ChipEffectTransform
This class represents a normalization method that corrects for GC-content effects on copy-number chip-effect estimates.
Usage
AdditiveCovariatesNormalization(dataSet=NULL, ..., target=NULL, subsetToFit="-XY",
shift=0, onMissing=c("median", "ignore"))
Arguments
dataSet |
|
... |
Additional arguments passed to the constructor of
|
target |
(Optional) A |
subsetToFit |
The units from which the normalization curve should
be estimated. If |
onMissing |
Specifies how to normalize units for which the GC contents are unknown. |
shift |
An optional amount the data points should be shifted (translated). |
Details
For SNPs, the normalization function is estimated based on the total chip effects, i.e. the sum of the allele signals. The normalizing is done by rescale the chip effects on the intensity scale such that the mean of the total chip effects are the same across samples for any given GC content. For allele-specific estimates, both alleles are always rescaled by the same amount. Thus, when normalizing allele-specific chip effects, the total chip effects is change, but not the relative allele signal, e.g. the allele B frequency.
Fields and Methods
Methods:
getCdf | - | |
process | Normalizes the data set. |
Methods inherited from ChipEffectTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AffineCnPlm class
Description
Package: aroma.affymetrix
Class AffineCnPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffinePlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffineSnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffineCnPlm
Directly known subclasses:
public abstract static class AffineCnPlm
extends CnPlm
Usage
AffineCnPlm(..., combineAlleles=FALSE)
Arguments
... |
Arguments passed to |
combineAlleles |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from CnPlm:
getCellIndices, getChipEffectSet, getCombineAlleles, getParameters, getProbeAffinityFile, setCombineAlleles
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from AffineSnpPlm:
getAsteriskTags
Methods inherited from AffinePlm:
getAsteriskTags, getFitUnitGroupFunction, getProbeAffinityFile
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AffinePlm class
Description
Package: aroma.affymetrix
Class AffinePlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffinePlm
Directly known subclasses:
AffineCnPlm, AffineSnpPlm
public abstract static class AffinePlm
extends ProbeLevelModel
This class represents affine model in Bengtsson & Hossjer (2006).
Usage
AffinePlm(..., background=TRUE)
Arguments
... |
Arguments passed to |
background |
If |
Fields and Methods
Methods:
getProbeAffinityFile | - |
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Model
For a single unit group, the affine model is:
y_{ik} = a + \theta_i \phi_k + \varepsilon_{ik}
where a is an offset common to all probe signals,
\theta_i are the chip effects for arrays i=1,...,I,
and \phi_k are the probe affinities for probes k=1,...,K.
The \varepsilon_{ik} are zero-mean noise with equal variance.
The model is constrained such that \prod_k \phi_k = 1.
Note that with the additional constraint a=0 (see arguments above),
the above model is very similar to MbeiPlm. The differences in
parameter estimates is due to difference is assumptions about the
error structure, which in turn affects how the model is estimated.
Author(s)
Henrik Bengtsson
References
Bengtsson & Hossjer (2006).
The AffineSnpPlm class
Description
Package: aroma.affymetrix
Class AffineSnpPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffinePlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffineSnpPlm
Directly known subclasses:
AffineCnPlm
public abstract static class AffineSnpPlm
extends SnpPlm
Usage
AffineSnpPlm(..., mergeStrands=FALSE)
Arguments
... |
Arguments passed to |
mergeStrands |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from AffinePlm:
getAsteriskTags, getFitUnitGroupFunction, getProbeAffinityFile
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AffymetrixCdfFile class
Description
Package: aroma.affymetrix
Class AffymetrixCdfFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaChipTypeAnnotationFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitAnnotationDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitTypesFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitNamesFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCdfFile
Directly known subclasses:
public abstract static class AffymetrixCdfFile
extends UnitNamesFile
An AffymetrixCdfFile object represents a generic Affymetrix CDF file.
Usage
AffymetrixCdfFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
convert | Converts a CDF into the same CDF but with another format. | |
createExonByTranscriptCdf | Creates an exon-by-transcript CDF. | |
getACSFile | - | |
getAromaCellSequenceFile | - | |
getCellIndices | Gets the cell indices unit by unit. | |
getChipType | - | |
getDimension | - | |
getFileFormat | - | |
getGenomeInformation | Gets genome information for this chip type. | |
getImage | - | |
getPlatform | - | |
getUnitNames | Gets the names of each unit. | |
getUnitTypes | Gets the types of a set of units. | |
hasUnitTypes | - | |
isMonocellCdf | - | |
isPm | Checks which cells (probes) are PMs and not. | |
isUniqueCdf | - | |
nbrOfCells | - | |
nbrOfColumns | - | |
nbrOfQcUnits | - | |
nbrOfRows | - | |
nbrOfUnits | - | |
readDataFrame | - | |
readUnits | Reads CDF data unit by unit. |
Methods inherited from UnitNamesFile:
getUnitNames, indexOf, nbrOfUnits
Methods inherited from UnitTypesFile:
getUnitTypes, nbrOfUnits
Methods inherited from UnitAnnotationDataFile:
byChipType, getAromaUflFile, getAromaUgpFile, getChipType, getDefaultExtension, getPlatform, nbrOfUnits
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaChipTypeAnnotationFile:
as.character, byChipType, byName, findByChipType, fromFile, getChipType, getDefaultExtension, getHeader, getPlatform
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson, Ken Simpson
Locates a CDF file from its chip type
Description
Locates a CDF file from its chip type.
Usage
## Static method (use this):
## AffymetrixCdfFile$findByChipType(chipType, tags=NULL, pattern=NULL, ...,
## .useAffxparser=TRUE)
## Don't use the below:
## S3 method for class 'AffymetrixCdfFile'
findByChipType(static, chipType, tags=NULL, pattern=NULL, ..., .useAffxparser=TRUE)
Arguments
chipType |
A |
tags |
|
pattern |
An optional |
... |
Not used. |
.useAffxparser |
Value
Returns a pathname as a character string to the first CDF file found.
If non CDF with requested chip type was found, NULL is returned.
See Also
For more information see AffymetrixCdfFile.
Defines an AffymetrixCdfFile object from a CDF file
Description
Defines an AffymetrixCdfFile object from a CDF file.
Usage
## Static method (use this):
## AffymetrixCdfFile$fromFile(filename, path=NULL, ...)
## Don't use the below:
## S3 method for class 'AffymetrixCdfFile'
fromFile(static, filename, path=NULL, ...)
Arguments
filename |
The filename of to the file. |
path |
The path to the file. |
... |
Not used. |
Value
Returns an instance of AffymetrixCdfFile or its subclasses.
If the file is not found or if it is of the wrong file format, an
error is thrown.
See Also
For more information see AffymetrixCdfFile.
The AffymetrixCelFile class
Description
Package: aroma.affymetrix
Class AffymetrixCelFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
Directly known subclasses:
ChipEffectFile, CnChipEffectFile, CnProbeAffinityFile, ExonChipEffectFile, ExonProbeAffinityFile, FirmaFile, ParameterCelFile, ProbeAffinityFile, QualityAssessmentFile, ResidualFile, SnpChipEffectFile, SnpProbeAffinityFile, WeightsFile
public abstract static class AffymetrixCelFile
extends AffymetrixFile
An AffymetrixCelFile object represents a single Affymetrix CEL file.
Usage
AffymetrixCelFile(..., cdf=NULL)
Arguments
... |
Arguments passed to |
cdf |
An optional |
Fields and Methods
Methods:
extractMatrix | - | |
getAm | - | |
getCdf | Gets the CDF structure for this CEL file. | |
getFileFormat | - | |
getImage | Creates an RGB Image object from a CEL file. | |
getUnitNamesFile | - | |
getUnitTypesFile | - | |
image270 | Displays all or a subset of the data spatially. | |
nbrOfCells | - | |
plotDensity | Plots the density of the probe signals on the array. | |
plotImage | Displays a spatial plot of a CEL file. | |
plotMvsA | Plots log-ratio versus log-intensity in a scatter plot. | |
plotMvsX | Plots log-ratio versus another variable in a scatter plot. | |
setCdf | Sets the CDF structure for this CEL file. | |
smoothScatterMvsA | Plots log-ratio versus log-intensity in a smooth scatter plot. | |
writeImage | Writes a spatial image of the signals in the CEL file. |
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
For developers
If you subclass this class, please make sure to query the
AffymetrixCdfFile object (see *getCdf()) whenever
querying CDF information. Do not use the CDF file inferred from the
chip type in CEL header, unless you really want it to be hardwired that
way, otherwise you will break to possibility to override the CDF
structure.
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically part of an AffymetrixCelSet.
Creates an empty CEL file from a template CDF
Description
Creates an empty CEL file from a template CDF.
Usage
## Static method (use this):
## AffymetrixCelFile$allocateFromCdf(cdf, name, tags=NULL, path=".", suffix=".CEL", ...,
## overwrite=FALSE, verbose=FALSE)
## Don't use the below:
## S3 method for class 'AffymetrixCelFile'
allocateFromCdf(static, cdf, name, tags=NULL, path=".", suffix=".CEL", ...,
overwrite=FALSE, verbose=FALSE)
Arguments
cdf |
A |
name, tags |
The name and the tags of the file created. |
path |
The directory where the file is created. |
suffix |
Filename suffix. |
... |
Arguments passed to |
overwrite |
If |
verbose |
See |
Value
Returns an AffymetrixCelFile.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Clears all or a subset of the fields in a CEL file
Description
Clears all or a subset of the fields in a CEL file.
Usage
## Static method (use this):
## AffymetrixCelFile$clearData(fields=c("intensities", "stdvs", "pixels"), value=0, ...,
## .forSure=FALSE, verbose=TRUE)
## Don't use the below:
## S3 method for class 'AffymetrixCelFile'
clearData(this, fields=c("intensities", "stdvs", "pixels"), value=0, ..., .forSure=FALSE,
verbose=TRUE)
Arguments
fields |
|
value |
A |
... |
Not used. |
.forSure |
If not |
verbose |
Value
Returns (invisibly) the names of the fields cleared.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Internally, updateCel is used.
Defines an AffymetrixCelFile object from a CEL file
Description
Defines an AffymetrixCelFile object from a CEL file.
Usage
## Static method (use this):
## AffymetrixCelFile$fromFile(filename, path=NULL, ..., verbose=FALSE, .checkArgs=TRUE)
## Don't use the below:
## S3 method for class 'AffymetrixCelFile'
fromFile(static, filename, path=NULL, ..., verbose=FALSE, .checkArgs=TRUE)
Arguments
filename |
The filename of to the file. |
path |
The path to the file. |
... |
Not used. |
Value
Returns an AffymetrixCelFile object.
If the file is not found or if it is of the wrong file format, an
error is thrown.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
The AffymetrixCelSet class
Description
Package: aroma.affymetrix
Class AffymetrixCelSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
Directly known subclasses:
ChipEffectSet, CnChipEffectSet, ExonChipEffectSet, FirmaSet, ParameterCelSet, QualityAssessmentSet, ResidualSet, SnpChipEffectSet, WeightsSet
public static class AffymetrixCelSet
extends AffymetrixFileSet
An AffymetrixCelSet object represents a set of Affymetrix CEL files with identical chip types.
Usage
AffymetrixCelSet(files=NULL, ...)
Arguments
files |
A |
... |
Not used. |
Fields and Methods
Methods:
as | - | |
as.AffymetrixCelSet | Coerce an object to an AffymetrixCelSet object. | |
byName | - | |
doCRMAv1 | - | |
doCRMAv2 | - | |
doFIRMA | - | |
doGCRMA | - | |
doRMA | - | |
extractAffyBatch | Extracts an in-memory AffyBatch object from the CEL set. | |
extractFeatureSet | Extracts CEL signals an in-memory FeatureSet object. | |
extractMatrix | Extract data as a matrix for a set of arrays. | |
getAverage | - | |
getAverageAsinh | - | |
getAverageFile | Calculates the mean and the standard deviation of the cell signal (intensity, standard deviation etc.) across the CEL set. | |
getAverageLog | - | |
getCdf | Gets the CDF structure for this CEL set. | |
getChipType | Gets the chip type for this CEL set. | |
getData | - | |
getIntensities | Gets cell intensities from a set of cells and a set of arrays. | |
getPlatform | - | |
getTimestamps | - | |
getUnitGroupCellMap | - | |
getUnitIntensities | Gets cell signals for a subset of units and a subset of arrays. | |
getUnitNamesFile | - | |
getUnitTypesFile | - | |
justSNPRMA | - | |
plotDensity | Plots the densities of all samples. | |
readUnits | - | |
setCdf | Sets the CDF structure for this CEL set. | |
writeSgr | - |
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
Examples
## Not run:
for (zzz in 0) {
# Find any dataset
path <- NULL
if (is.null(path))
break
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Define a dataset object based on all CEL files in a directory
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
ds <- AffymetrixCelSet$fromFiles(path)
print(ds)
# Keep at most three arrays for this example
ds <- ds[1:min(3,nbrOfArrays(ds))]
print(ds)
} # for (zzz in 0)
rm(zzz)
## End(Not run)
Imports dChip-exported CEL files
Description
Imports dChip-exported CEL files into a directory structure recognized by this package. ASCII CEL files are converted to binary CEL files, and for chip types where the array data is rotated 90-degrees counter clockwise by dChip, the data is rotated back.
As of 2007-03-28, dChip rotates data for exon, tiling, and Mapping 500K arrays.
Usage
## Static method (use this):
## AffymetrixCelSet$importFromDChip(path, name=NULL, tags="dChip", rootPath="probeData",
## rotateBack=NA, ..., skip=TRUE, verbose=FALSE)
## Don't use the below:
## S3 method for class 'AffymetrixCelSet'
importFromDChip(static, path, name=NULL, tags="dChip", rootPath="probeData",
rotateBack=NA, ..., skip=TRUE, verbose=FALSE)
Arguments
path |
The path to all dChip-exported CEL files. |
name |
The name of the output data set.
If |
tags |
Tags added to the imported data set. |
rootPath |
The root path where to store the data set. |
rotateBack |
If |
... |
Additional arguments passed to |
skip |
If |
verbose |
See |
Details
Note that dChip stores CEL intensities as 16-bit integers in its *.dcp files, although CEL files are capable or holding floats. This means that you might loose precision if first import data in to dChip and then export it data again.
Value
Returns an AffymetrixCelSet.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelSet.
The AffymetrixCelSetReporter class
Description
Package: aroma.affymetrix
Class AffymetrixCelSetReporter
Object
~~|
~~+--GenericReporter
~~~~~~~|
~~~~~~~+--AffymetrixFileSetReporter
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AffymetrixCelSetReporter
Directly known subclasses:
SpatialReporter
public abstract static class AffymetrixCelSetReporter
extends AffymetrixFileSetReporter
Usage
AffymetrixCelSetReporter(..., .setClass="AffymetrixCelSet")
Arguments
... |
Arguments passed to |
.setClass |
The name of the class of the input set. |
Fields and Methods
Methods:
getDataSet | Gets the data set. |
Methods inherited from AffymetrixFileSetReporter:
getFileSet, getInputName, getInputTags
Methods inherited from GenericReporter:
as.character, getAlias, getAsteriskTags, getFullName, getInputName, getInputTags, getMainPath, getName, getPath, getReportSet, getRootPath, getTags, process, setAlias, setup
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AffymetrixCelSetTuple class
Description
Package: aroma.affymetrix
Class AffymetrixCelSetTuple
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSetList
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSetTuple
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AffymetrixCelSetTuple
Directly known subclasses:
ChipEffectSetTuple, CnChipEffectSetTuple
public static class AffymetrixCelSetTuple
extends AromaMicroarrayDataSetTuple
Usage
AffymetrixCelSetTuple(..., .setClass="AffymetrixCelSet")
Arguments
... |
Arguments passed to the constructor of
|
.setClass |
The name of the class of the input set. |
Fields and Methods
Methods:
byPath | - |
Methods inherited from AromaMicroarrayDataSetTuple:
as, as.AromaMicroarrayDataSetTuple, byPath, getAsteriskTags, getChipTypes, getFullNames, getSets, getTags, indexOf, nbrOfChipTypes
Methods inherited from GenericDataFileSetList:
as, as.GenericDataFileSetList, as.character, as.data.frame, as.list, assertDuplicates, clone, extract, getAsteriskTags, getDefaultFullName, getFileList, getFileListClass, getFullNames, getNames, getSet, getSets, getTags, indexOf, length, nbrOfFiles, nbrOfSets, setTags
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AffymetrixCnChpSet class
Description
Package: aroma.affymetrix
Class AffymetrixCnChpSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCnChpSet
Directly known subclasses:
public abstract static class AffymetrixCnChpSet
extends AffymetrixFileSet
A AffymetrixCnChpSet object represents a set of AffymetrixCnChpFile:s with identical chip types.
Usage
AffymetrixCnChpSet(files=NULL, ...)
Arguments
files |
A |
... |
Not used. |
Fields and Methods
Methods:
as | - | |
as.AffymetrixCnChpSet | Coerce an object to an AffymetrixCnChpSet object. | |
exportTotalCnRatioSet | - | |
extractLogRatios | - | |
findByName | - | |
getCdf | - | |
setCdf | - |
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
The abstract AffymetrixFile class
Description
Package: aroma.affymetrix
Class AffymetrixFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
Directly known subclasses:
AffymetrixCdfFile, AffymetrixCelFile, AffymetrixCnChpFile, AffymetrixPgfFile, AffymetrixTsvFile, AromaChipTypeAnnotationFile, ChipEffectFile, CnChipEffectFile, CnProbeAffinityFile, CnagCfhFile, DChipCdfBinFile, DChipDcpFile, ExonChipEffectFile, ExonProbeAffinityFile, FirmaFile, ParameterCelFile, ProbeAffinityFile, QualityAssessmentFile, ResidualFile, SnpChipEffectFile, SnpProbeAffinityFile, WeightsFile
public abstract static class AffymetrixFile
extends AromaPlatformInterface
An AffymetrixFile object represents a single Affymetrix file,
e.g. an Affymetrix CEL file or an Affymetrix CDF file.
Note that this class is abstract and can not be instanciated, but
instead you have to use one of the subclasses or the generic
fromFile() method.
Usage
AffymetrixFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
No methods defined.
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically part of an AffymetrixFileSet.
The AffymetrixFileSet class
Description
Package: aroma.affymetrix
Class AffymetrixFileSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
Directly known subclasses:
AffymetrixCelSet, AffymetrixCnChpSet, ChipEffectSet, CnChipEffectSet, DChipDcpSet, ExonChipEffectSet, FirmaSet, ParameterCelSet, QualityAssessmentSet, ResidualSet, SnpChipEffectSet, WeightsSet
public abstract static class AffymetrixFileSet
extends AromaPlatformInterface
An AffymetrixFileSet object represents a set of AffymetrixFiles
with identical chip types.
Usage
AffymetrixFileSet(files=NULL, ...)
Arguments
files |
A |
... |
Arguments passed to |
Fields and Methods
Methods:
as | - | |
as.AffymetrixFileSet | Coerce an object to an AffymetrixFileSet object. | |
byPath | Defines an AffymetrixFileSet object by searching for Affymetrix files. |
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Defines an AffymetrixFileSet object by searching for Affymetrix files
Description
Defines an AffymetrixFileSet object by searching for Affymetrix files.
Usage
## Static method (use this):
## AffymetrixFileSet$byPath(..., fileClass="AffymetrixFile")
## Don't use the below:
## S3 method for class 'AffymetrixFileSet'
byPath(static, ..., fileClass="AffymetrixFile")
Arguments
... |
Additional arguments passed to the constructor of the static (calling) class. |
fileClass |
The name of the |
Value
Returns an AffymetrixFileSet object.
Reserved filenames
Note that files with names starting with a period . are not
searched for. The reason for this is that such files are reserved for
internal use of this package. For instance, the package store average
signals across CEL files in a file named as .average<something>.CEL
in the same directory as the CEL files, and when such a directory is
scanned we do not want such files to be interpreted as data.
See Also
For more information see AffymetrixFileSet.
The AffymetrixFileSetReporter class
Description
Package: aroma.affymetrix
Class AffymetrixFileSetReporter
Object
~~|
~~+--GenericReporter
~~~~~~~|
~~~~~~~+--AffymetrixFileSetReporter
Directly known subclasses:
AffymetrixCelSetReporter, SpatialReporter
public abstract static class AffymetrixFileSetReporter
extends GenericReporter
Usage
AffymetrixFileSetReporter(set=NULL, ..., .setClass="AffymetrixFileSet")
Arguments
set |
An |
... |
Arguments passed to |
.setClass |
The name of the class of the input set. |
Fields and Methods
Methods:
getInputName | - | |
getInputTags | - |
Methods inherited from GenericReporter:
as.character, getAlias, getAsteriskTags, getFullName, getInputName, getInputTags, getMainPath, getName, getPath, getReportSet, getRootPath, getTags, process, setAlias, setup
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AffymetrixPgfFile class
Description
Package: aroma.affymetrix
Class AffymetrixPgfFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaChipTypeAnnotationFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitAnnotationDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitTypesFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitNamesFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixPgfFile
Directly known subclasses:
public abstract static class AffymetrixPgfFile
extends UnitNamesFile
An AffymetrixPgfFile object represents a generic Affymetrix Probe Group File (PGF). A PGF file "provides information about what probes are contained within a probeset and information about the nature of the probes necessary for analysis. The current PGF file format (version 1) is only specified for expression style probesets." [1]
Usage
AffymetrixPgfFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
getChipType | - | |
getDimension | - | |
getPlatform | - | |
getUnitNames | Gets the names of each unit. | |
nbrOfCells | - | |
nbrOfColumns | - | |
nbrOfRows | - | |
nbrOfUnits | - |
Methods inherited from UnitNamesFile:
getUnitNames, indexOf, nbrOfUnits
Methods inherited from UnitTypesFile:
getUnitTypes, nbrOfUnits
Methods inherited from UnitAnnotationDataFile:
byChipType, getAromaUflFile, getAromaUgpFile, getChipType, getDefaultExtension, getPlatform, nbrOfUnits
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaChipTypeAnnotationFile:
as.character, byChipType, byName, findByChipType, fromFile, getChipType, getDefaultExtension, getHeader, getPlatform
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
References
[1] ...
Locates a PGF file from its chip type
Description
Locates a PGF file from its chip type.
Usage
## Static method (use this):
## AffymetrixPgfFile$findByChipType(chipType, tags=NULL, pattern=NULL, ...)
## Don't use the below:
## S3 method for class 'AffymetrixPgfFile'
findByChipType(static, chipType, tags=NULL, pattern=NULL, ...)
Arguments
chipType |
A |
tags |
|
pattern |
An optional |
... |
Not used. |
Value
Returns a pathname as a character string to the first PGF file found.
If non PGF with requested chip type was found, NULL is returned.
See Also
For more information see AffymetrixPgfFile.
Defines an AffymetrixPgfFile object from a PGF file
Description
Defines an AffymetrixPgfFile object from a PGF file.
Usage
## Static method (use this):
## AffymetrixPgfFile$fromFile(filename, path=NULL, ...)
## Don't use the below:
## S3 method for class 'AffymetrixPgfFile'
fromFile(static, filename, path=NULL, ...)
Arguments
filename |
The filename of to the file. |
path |
The path to the file. |
... |
Not used. |
Value
Returns an instance of AffymetrixPgfFile or its subclasses.
If the file is not found or if it is of the wrong file format, an
error is thrown.
See Also
For more information see AffymetrixPgfFile.
The AffymetrixProbeTabFile class
Description
Package: aroma.affymetrix
Class AffymetrixProbeTabFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--ColumnNamesInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--GenericTabularFile
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--TabularTextFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixProbeTabFile
Directly known subclasses:
public abstract static class AffymetrixProbeTabFile
extends AromaPlatformInterface
An AffymetrixProbeTabFile represents an interface to query the data
contained in an Affymetrix probe tab file, e.g.
Mapping250K_Nsp_probe_tab.
Usage
AffymetrixProbeTabFile(...)
Arguments
... |
Arguments passed to the constructor of |
Fields and Methods
Methods:
byChipType | - | |
getCdf | - | |
getChipType | - | |
getColumnNames | - | |
getData | - |
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from TabularTextFile:
as.character, getCommentChar, getDefaultColumnClassPatterns, getDefaultColumnClasses, getDefaultColumnNames, getHeader, getReadArguments, hasColumnHeader, nbrOfLines, nbrOfRows, readColumnNames, readColumns, readDataFrame, readLines, readRawHeader, setCommentChar
Methods inherited from GenericTabularFile:
[, as.character, dim, extractMatrix, head, nbrOfColumns, nbrOfRows, readColumns, readDataFrame, tail, writeColumnsToFiles
Methods inherited from ColumnNamesInterface:
appendColumnNamesTranslator, appendColumnNamesTranslatorByNULL, appendColumnNamesTranslatorBycharacter, appendColumnNamesTranslatorByfunction, appendColumnNamesTranslatorBylist, clearColumnNamesTranslator, clearListOfColumnNamesTranslators, getColumnNames, getColumnNamesTranslator, getDefaultColumnNames, getListOfColumnNamesTranslators, nbrOfColumns, setColumnNames, setColumnNamesTranslator, setListOfColumnNamesTranslators, updateColumnNames
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
About probe-tab files
Probe-tab files are provided by Affymetrix and contains information on the probes. Note that not necessarily all probes are represented in the files, e.g. typically only PM probes are given and MM are left to be inferred from the PMs.
The below is an extract of the Mapping250K_Nsp_probe_tab file
obtained from the Affymetrix website. Note that columns are separated
by TABs.
SNP_A-1780270 1633 2398 3 TTGTTAAGCAAGTGAGTTATTTTAT f PM C SNP_A-1780270 1633 2399 3 TTGTTAAGCAAGTGACTTATTTTAT f PM G SNP_A-1780270 1951 1780 -4 GGATAAAATAAAATAACTCACTTGC r PM C ... SNP_A-4241299 2553 1658 4 AAACACATTTTTGGGTCGTAAGGAA f PM G
Author(s)
Henrik Bengtsson
The AlleleSummation class
Description
Package: aroma.affymetrix
Class AlleleSummation
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AlleleSummation
Directly known subclasses:
public abstract static class AlleleSummation
extends UnitModel
This class takes allele-specific chip effect estimates of a SnpChipEffectSet and returns a CnChipEffectSet holding the summed allele estimates.
Usage
AlleleSummation(dataSet=NULL, ignoreNAs=TRUE, ...)
Arguments
dataSet |
|
ignoreNAs |
If |
... |
Arguments passed to |
Fields and Methods
Methods:
findUnitsTodo | - | |
getChipEffectSet | Gets the set of chip effects for this model. | |
process | - |
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AllelicCrosstalkCalibration class
Description
Package: aroma.affymetrix
Class AllelicCrosstalkCalibration
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AllelicCrosstalkCalibration
Directly known subclasses:
public static class AllelicCrosstalkCalibration
extends ProbeLevelTransform
This class represents a calibration function that transforms the probe-level signals such that the signals from the two alleles are orthogonal. The method fits and calibrates PM signals only. MM signals will not affect the model fitting and are unaffected.
Usage
AllelicCrosstalkCalibration(dataSet=NULL, ..., model=c("asis", "auto", "CRMA", "CRMAv2"),
rescaleBy=c("auto", "groups", "all", "none"), targetAvg=c(2200, 2200),
subsetToAvg="-XY", mergeShifts=TRUE, B=1, flavor=c("sfit", "expectile"),
alpha=c(0.1, 0.075, 0.05, 0.03, 0.01), q=2, Q=98, lambda=2,
pairBy=c("CDF", "sequence"))
Arguments
dataSet |
An |
... |
Arguments passed to the constructor of
|
model |
A |
rescaleBy |
A |
targetAvg |
The signal(s) that either the average of the sum
(if one target value) or the average of each of the alleles
(if two target values) should have after calibration.
Only used if |
subsetToAvg |
The indices of the cells (taken as the intersect of
existing indices) used to calculate average in order to rescale to
the target average. If |
mergeShifts |
If |
B |
An |
flavor |
A |
alpha, q, Q, lambda |
Model fitting parameters. |
pairBy |
A |
What probe signals are updated?
Calibration for crosstalk between allele signals applies by definition only SNP units. Furthermore, it is only SNP units with two or four unit groups that are calibrated. For instance, in at least on custom SNP CDFs we know of, there is a small number of SNP units that have six groups. Currently these units are not calibrated (at all). It is only PM probes that will be calibrated. Note that, non-calibrated signals will be saved in the output files.
What probe signals are used to fit model?
All PM probe pairs are used to fit the crosstalk model. In the second step where signals are rescaled to a target average, it is possible to specify the set of cells that should be included when estimating the target average.
Important about rescaling towards target average
Rescaling each allele-pair group (e.g. AC, AG, AT, CG, CT, GC)
towards a target average (rescaleBy="groups")
must not be used for multi-enzyme chip types,
e.g. GenomeWideSNP_6.
If still done, due to confounded effects of non-perfect enzyme
mixtures etc, there will be a significant bias between raw CNs
for SNPs and CN probes.
Instead, for such chip types all probe signals should be
rescale together towards the target average (rescaleBy="all").
Fields and Methods
Methods:
process | Calibrates the data set. |
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AromaChipTypeAnnotationFile class
Description
Package: aroma.affymetrix
Class AromaChipTypeAnnotationFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaChipTypeAnnotationFile
Directly known subclasses:
AffymetrixCdfFile, AffymetrixPgfFile
public abstract static class AromaChipTypeAnnotationFile
extends AffymetrixFile
An AromaChipTypeAnnotationFile object represents an annotation file for a specific chip type.
Usage
AromaChipTypeAnnotationFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
byChipType | Defines an AromaChipTypeAnnotationFile object by chip type. | |
getChipType | - | |
getHeader | Gets the header of the annotation file. | |
getPlatform | - |
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Defines an AromaChipTypeAnnotationFile object by chip type
Description
Defines an AromaChipTypeAnnotationFile object by chip type.
Usage
## Static method (use this):
## AromaChipTypeAnnotationFile$byChipType(chipType, tags=NULL, ..., verbose=FALSE)
## Don't use the below:
## S3 method for class 'AromaChipTypeAnnotationFile'
byChipType(static, chipType, tags=NULL, ..., verbose=FALSE)
Arguments
chipType |
A |
tags |
|
... |
Not used. |
verbose |
See |
Value
Returns an AromaChipTypeAnnotationFile object.
See Also
*fromFile().
For more information see AromaChipTypeAnnotationFile.
Sets up an AromaChipTypeAnnotationFile
Description
Sets up an AromaChipTypeAnnotationFile.
Usage
## Static method (use this):
## AromaChipTypeAnnotationFile$fromFile(filename, path=NULL, ...)
## Don't use the below:
## S3 method for class 'AromaChipTypeAnnotationFile'
fromFile(static, filename, path=NULL, ...)
Arguments
filename |
The filename of to the file. |
path |
The path to the file. |
... |
Not used. |
Value
Returns an instance of AromaChipTypeAnnotationFile or its subclasses.
If the file is not found or if it is of the wrong file format, an
error is thrown.
See Also
*byChipType().
For more information see AromaChipTypeAnnotationFile.
Creates an AromaUnitTabularBinaryFile mapping to a given CDF
Description
Creates an AromaUnitTabularBinaryFile mapping to a given CDF.
Usage
## Static method (use this):
## AromaUnitTabularBinaryFile$allocateFromCdf(cdf, ...)
## Don't use the below:
## S3 method for class 'AromaUnitTabularBinaryFile'
allocateFromCdf(static, cdf, ...)
Arguments
cdf |
The |
... |
Additional arguments passed to |
Value
Returns a AromaUnitTabularBinaryFile object.
Author(s)
Henrik Bengtsson
See Also
To update to file footer afterwards, see writeFooter().
The ArrayExplorer class
Description
Package: aroma.affymetrix
Class ArrayExplorer
Object
~~|
~~+--Explorer
~~~~~~~|
~~~~~~~+--ArrayExplorer
Directly known subclasses:
public abstract static class ArrayExplorer
extends Explorer
Usage
ArrayExplorer(csTuple=NULL, ...)
Arguments
csTuple |
An |
... |
Not used. |
Fields and Methods
Methods:
addColorMap | - | |
getColorMaps | - | |
getDataSet | Gets the data set. | |
getSetTuple | - | |
nbrOfChipTypes | - | |
process | Generates image files, scripts and dynamic pages for the explorer. | |
setArrays | Sets the arrays. | |
setColorMaps | - |
Methods inherited from Explorer:
addIncludes, addIndexFile, as.character, display, getAlias, getArraysOfInput, getAsteriskTags, getFullName, getIncludePath, getMainPath, getName, getNameOfInput, getNames, getPath, getReportPathPattern, getRootPath, getSampleLayerPrefix, getSubname, getTags, getTagsOfInput, getTemplatePath, getVersion, nbrOfArrays, process, setAlias, setArrays, setReportPathPattern, setSubname, setup, splitByReportPathPattern, updateSetupExplorerFile
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AvgCnPlm class
Description
Package: aroma.affymetrix
Class AvgCnPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AvgPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AvgSnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AvgCnPlm
Directly known subclasses:
public abstract static class AvgCnPlm
extends CnPlm
Usage
AvgCnPlm(..., combineAlleles=FALSE)
Arguments
... |
Arguments passed to |
combineAlleles |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from CnPlm:
getCellIndices, getChipEffectSet, getCombineAlleles, getParameters, getProbeAffinityFile, setCombineAlleles
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from AvgSnpPlm:
getAsteriskTags
Methods inherited from AvgPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, validate
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The AvgPlm class
Description
Package: aroma.affymetrix
Class AvgPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AvgPlm
Directly known subclasses:
AvgCnPlm, AvgSnpPlm
public abstract static class AvgPlm
extends ProbeLevelModel
This class represents a PLM where the probe intensities are averaged assuming identical probe affinities. For instance, one may assume that replicated probes with identical sequences have the same probe affinities, cf. the GenomeWideSNP_6 chip type.
Usage
AvgPlm(..., flavor=c("median", "mean"))
Arguments
... |
Arguments passed to |
flavor |
A |
Fields and Methods
Methods:
No methods defined.
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Model
For a single unit group, the averaging PLM of K probes is:
y_{ik} = \theta_i + \varepsilon_{ik}
where \theta_i are the chip effects for arrays i=1,...,I.
The \varepsilon_{ik} are zero-mean noise with equal variance.
Different flavors of model fitting
The above model can be fitted in two ways, either robustly or
non-robustly.
Use argument flavor="mean" to fit the model non-robustly, i.e.
\hat{\theta}_{i} = 1/K \sum_k y_{ik}
.
Use argument flavor="median" to fit the model robustly, i.e.
\hat{\theta}_{i} = median_k y_{ik}
.
Missing values are always excluded.
Author(s)
Henrik Bengtsson
The AvgSnpPlm class
Description
Package: aroma.affymetrix
Class AvgSnpPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AvgPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AvgSnpPlm
Directly known subclasses:
AvgCnPlm
public abstract static class AvgSnpPlm
extends SnpPlm
Usage
AvgSnpPlm(..., mergeStrands=FALSE)
Arguments
... |
Arguments passed to |
mergeStrands |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from AvgPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, validate
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The BackgroundCorrection class
Description
Package: aroma.affymetrix
Class BackgroundCorrection
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--BackgroundCorrection
Directly known subclasses:
GcRmaBackgroundCorrection, LimmaBackgroundCorrection, NormExpBackgroundCorrection, OpticalBackgroundCorrection, RmaBackgroundCorrection
public abstract static class BackgroundCorrection
extends ProbeLevelTransform
This class represents a background adjustment function.
Usage
BackgroundCorrection(..., subsetToUpdate=NULL, typesToUpdate=NULL)
Arguments
... |
Arguments passed to the constructor of
|
subsetToUpdate |
The probes to be updated.
If |
typesToUpdate |
Types of probes to be updated. |
Fields and Methods
Methods:
process | Processes the data set. |
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
The BaseCountNormalization class
Description
Package: aroma.affymetrix
Class BaseCountNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AbstractProbeSequenceNormalization
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--BaseCountNormalization
Directly known subclasses:
public static class BaseCountNormalization
extends AbstractProbeSequenceNormalization
This class represents a normalization method that corrects for systematic effects in the probe intensities due to differences in the number of A, C, G, and T:s in the probe sequences.
Usage
BaseCountNormalization(..., model=c("robustSmoothSpline", "lm"), bootstrap=FALSE)
Arguments
... |
Arguments passed to the constructor of
|
model |
A |
bootstrap |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from AbstractProbeSequenceNormalization:
fitOne, getAromaCellSequenceFile, getParameters, getTargetFile, indexOfMissingSequences, predictOne, process
Methods inherited from ProbeLevelTransform3:
getAsteriskTags, getCellsTo, getCellsToFit, getCellsToUpdate, getParameters, getUnitsTo, getUnitsToFit, getUnitsToUpdate, writeSignals
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Requirements
This class requires that an aroma probe sequence file is available for the chip type.
Author(s)
Henrik Bengtsson
The BasePositionNormalization class
Description
Package: aroma.affymetrix
Class BasePositionNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AbstractProbeSequenceNormalization
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--LinearModelProbeSequenceNormalization
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--BasePositionNormalization
Directly known subclasses:
public abstract static class BasePositionNormalization
extends LinearModelProbeSequenceNormalization
This class represents a normalization method that corrects for systematic effects in the probe intensities due to differences in positioning of A, C, G, and T:s in the probe sequences.
Usage
BasePositionNormalization(..., model=c("smooth.spline"), df=5)
Arguments
... |
Arguments passed to the constructor of
|
model |
A |
df |
The degrees of freedom of the model. |
Fields and Methods
Methods:
No methods defined.
Methods inherited from LinearModelProbeSequenceNormalization:
fitOne, getDesignMatrix, getNormalEquations, getSignalTransform, predictOne
Methods inherited from AbstractProbeSequenceNormalization:
fitOne, getAromaCellSequenceFile, getParameters, getTargetFile, indexOfMissingSequences, predictOne, process
Methods inherited from ProbeLevelTransform3:
getAsteriskTags, getCellsTo, getCellsToFit, getCellsToUpdate, getParameters, getUnitsTo, getUnitsToFit, getUnitsToUpdate, writeSignals
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson, Mark Robinson
The ChipEffectFile class
Description
Package: aroma.affymetrix
Class ChipEffectFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectFile
Directly known subclasses:
CnChipEffectFile, ExonChipEffectFile, SnpChipEffectFile
public abstract static class ChipEffectFile
extends ParameterCelFile
This class represents estimates of chip effects in the probe-level models.
Usage
ChipEffectFile(..., probeModel=c("pm"))
Arguments
... |
Arguments passed to |
probeModel |
The specific type of model, e.g. |
Fields and Methods
Methods:
extractMatrix | - | |
extractTheta | - | |
findUnitsTodo | - | |
getAM | Gets the log-intensities and log-ratios of chip effects for two arrays. | |
readUnits | - |
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically obtained through the
getChipEffectSet() method for the ProbeLevelModel class.
An object of this class is typically part of a ChipEffectSet.
Retrieve an existing CEL file, or create from CDF template if missing
Description
Retrieve an existing CEL file, or create from CDF template if missing.
Usage
## Static method (use this):
## ChipEffectFile$fromDataFile(df=NULL, filename=sprintf("%s,chipEffects.CEL",
## getFullName(df)), path, name=getName(df), cdf=NULL, ..., verbose=FALSE)
## Don't use the below:
## S3 method for class 'ChipEffectFile'
fromDataFile(static, df=NULL, filename=sprintf("%s,chipEffects.CEL", getFullName(df)),
path, name=getName(df), cdf=NULL, ..., verbose=FALSE)
Arguments
static |
|
df |
|
filename |
The filename of the CEL file. |
path |
The path to the directory where to find/create the CEL file. |
name |
The name of the array to be stored in the CEL header. |
cdf |
The template |
... |
Passed to |
verbose |
See |
Value
Returns a ChipEffectFile.
Author(s)
Henrik Bengtsson
See Also
allocateFromCdf() of AffymetrixCelFile.
For more information see ChipEffectFile.
The ChipEffectGroupMerge class
Description
Package: aroma.affymetrix
Class ChipEffectGroupMerge
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectGroupMerge
Directly known subclasses:
SnpChipEffectGroupMerge
public static class ChipEffectGroupMerge
extends ChipEffectTransform
This class represents a method that merges chip effects across groups unit by unit.
Usage
ChipEffectGroupMerge(dataSet=NULL, fcn=NULL, ...)
Arguments
dataSet |
|
fcn |
A |
... |
Additional arguments passed to the constructor of
|
Fields and Methods
Methods:
getCdf | - | |
getMergeFunction | - | |
process | Normalizes the data set. | |
setMergeFunction | - |
Methods inherited from ChipEffectTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The ChipEffectSet class
Description
Package: aroma.affymetrix
Class ChipEffectSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectSet
Directly known subclasses:
CnChipEffectSet, ExonChipEffectSet, SnpChipEffectSet
public static class ChipEffectSet
extends ParameterCelSet
This class represents estimates of chip effects in the probe-level models.
Usage
ChipEffectSet(..., probeModel=c("pm"))
Arguments
... |
Arguments passed to |
probeModel |
The specific type of model, e.g. |
Fields and Methods
Methods:
boxplotStats | - | |
extractExpressionSet | Extracts an in-memory ExpressionSet object. | |
extractMatrix | - | |
extractTheta | - | |
findUnitsTodo | - | |
getAM | Gets the log-intensities and log-ratios of chip effects of the set relative to a reference chip effect file. | |
getAverageFile | - | |
getCellIndices | - | |
plotBoxplot | - | |
readUnits | - |
Methods inherited from ParameterCelSet:
extractDataFrame, extractMatrix
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically obtained through the
getChipEffectSet() method for the ProbeLevelModel class.
The ChipEffectTransform class
Description
Package: aroma.affymetrix
Class ChipEffectTransform
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
Directly known subclasses:
AdditiveCovariatesNormalization, ChipEffectGroupMerge, FragmentEquivalentClassNormalization, FragmentLengthNormalization, GcContentNormalization, GcContentNormalization2, SnpChipEffectGroupMerge
public abstract static class ChipEffectTransform
extends Transform
This abstract class represents a transform that transforms chip-effect estimates obtained from probe-level modeling.
Usage
ChipEffectTransform(dataSet=NULL, ...)
Arguments
dataSet |
The input data set as an |
... |
Arguments passed to the constructor of |
Details
Subclasses must implement the process() method.
Fields and Methods
Methods:
No methods defined.
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The CnChipEffectFile class
Description
Package: aroma.affymetrix
Class CnChipEffectFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpChipEffectFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CopyNumberDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnChipEffectFile
Directly known subclasses:
public abstract static class CnChipEffectFile
extends CopyNumberDataFile
This class represents estimates of chip effects in a copy-number probe-level models.
Usage
CnChipEffectFile(..., combineAlleles=FALSE)
Arguments
... |
Arguments passed to |
combineAlleles |
A |
Fields and Methods
Methods:
exportTotalAndFracB | - | |
extractTheta | - | |
extractTotalAndFreqB | - | |
hasAlleleBFractions | - | |
hasStrandiness | - | |
mergeStrands | - | |
readUnits | - |
Methods inherited from CopyNumberDataFile:
as, as.CopyNumberDataFile, getNumberOfFilesAveraged, hasAlleleBFractions, hasStrandiness
Methods inherited from SnpChipEffectFile:
exportTotalAndFracB, extractCNT, extractTheta, extractTotalAndFracB, getCellIndices, getExpandedCellMap, getParameters, mergeStrands, readUnits, writeCNT
Methods inherited from ChipEffectFile:
as.character, extractChromosomalDataFrame, extractMatrix, extractTheta, findUnitsTodo, getAM, getAsFullCelFile, getCellIndices, getCellMapForMainCdf, getExpandedCellMap, getParameters, getUnitGroupCellArrayMap, getUnitGroupCellMatrixMap, getXAM, mergeGroups, readUnits, writeAsFullCelFile
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically part of a CnChipEffectSet.
The CnChipEffectSet class
Description
Package: aroma.affymetrix
Class CnChipEffectSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpChipEffectSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CopyNumberDataSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnChipEffectSet
Directly known subclasses:
public static class CnChipEffectSet
extends CopyNumberDataSet
This class represents estimates of chip effects in the probe-level models.
Usage
CnChipEffectSet(..., combineAlleles="byFirstFile")
Arguments
... |
Arguments passed to |
combineAlleles |
A |
Fields and Methods
Methods:
as.CopyNumberDataSetTuple | - | |
exportTotalAndFracB | - | |
extractTheta | - | |
extractTotalAndFreqB | - | |
getAverageFile | - | |
getCombineAlleles | - | |
hasAlleleBFractions | - | |
hasStrandiness | - | |
setCombineAlleles | - | |
writeWig | - |
Methods inherited from CopyNumberDataSet:
as, as.CopyNumberDataSet, doCBS, hasAlleleBFractions, hasStrandiness
Methods inherited from SnpChipEffectSet:
byPath, exportTotalAndFracB, extractAlleleSet, extractCNT, extractSnpCnvQSet, extractSnpQSet, extractTheta, extractTotalAndFreqB, getAverageFile, getBaseline, getMergeStrands, setMergeStrands, writeCNT
Methods inherited from ChipEffectSet:
as.character, boxplotStats, byPath, calculateBaseline, calculateFieldBoxplotStats, calculateNuseBoxplotStats, calculateRleBoxplotStats, extractAffyBatch, extractChromosomalDataFrame, extractExpressionSet, extractMatrix, extractTheta, findByName, findUnitsTodo, fromDataSet, getAM, getAsFullCelSet, getAverageFile, getBaseline, getCellIndices, getXAM, plotBoxplot, readUnits, updateUnits
Methods inherited from ParameterCelSet:
extractDataFrame, extractMatrix
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Imports copy-number estimates from an APT summary file
Description
Imports copy-number estimates from an APT summary file. Currently only total copy-number estimates can be imported.
Usage
## Static method (use this):
## CnChipEffectSet$importFromApt(filename, path=NULL, combineAlleles=TRUE, cdf, ...,
## skip=TRUE, verbose=FALSE)
## Don't use the below:
## S3 method for class 'CnChipEffectSet'
importFromApt(static, filename, path=NULL, combineAlleles=TRUE, cdf, ..., skip=TRUE,
verbose=FALSE)
Arguments
filename |
The filename of the APT summary file. |
path |
An optional path to the file. |
combineAlleles |
If |
cdf |
An |
... |
Not used. |
skip |
If |
verbose |
See |
Details
This import method is robust and memory efficient. One array at the time is imported by first writing to a temporary file which is then renamed to the final name, if import was successful. (If the import failed, a temporary file will rename that has to be deleted manually).
Since only one array at the time is imported, the memory overhead will be bounded allowing to import very large tab-delimited data files containing a large number of arrays. Unfortunately, this approach slows down the reading substantially, because in each import all but one column is parsed but ignored.
Value
Returns an CnChipEffectSet.
Author(s)
Henrik Bengtsson
See Also
For more information see CnChipEffectSet.
Imports copy-number estimates from a dChip result file
Description
Imports copy-number estimates from a dChip result file. Currently only total copy-number estimates can be imported, that is if dChip fitted the PLM with allele A and allele B combined.
Usage
## Static method (use this):
## CnChipEffectSet$importFromDChip(filename, path=NULL, combineAlleles=TRUE, cdf, ...,
## skip=TRUE, verbose=FALSE)
## Don't use the below:
## S3 method for class 'CnChipEffectSet'
importFromDChip(static, filename, path=NULL, combineAlleles=TRUE, cdf, ..., skip=TRUE,
verbose=FALSE)
Arguments
filename |
The filename of the dChip result file. |
path |
An optional path to the file. |
combineAlleles |
If |
cdf |
An |
... |
Not used. |
skip |
If |
verbose |
See |
Details
This import method is robust and memory efficient. One array at the time is imported by first writing to a temporary file which is then renamed to the final name, if import was successful. (If the import failed, a temporary file will rename that has to be deleted manually).
Since only one array at the time is imported, the memory overhead will be bounded allowing to import very large tab-delimited data files containing a large number of arrays. Unfortunately, this approach slows down the reading substantially, because in each import all but one column is parsed but ignored.
Value
Returns an CnChipEffectSet.
Author(s)
Henrik Bengtsson
See Also
For more information see CnChipEffectSet.
The CnPlm class
Description
Package: aroma.affymetrix
Class CnPlm
Interface
~~|
~~+--SnpPlm
~~~~~~~|
~~~~~~~+--CnPlm
Directly known subclasses:
AffineCnPlm, AvgCnPlm, HetLogAddCnPlm, MbeiCnPlm, RmaCnPlm
public class CnPlm
extends SnpPlm
This support class represents a SnpPlm specially designed for
copy-number analysis.
Usage
CnPlm(...)
Arguments
... |
Arguments passed to |
Details
Models implementing this copy-number PLM, provides either
allele-specific or total copy-number estimates.
For allele-specific CNs the underlying SnpPlm model is fitted as
is, i.e. for each allele separately with or without the strands first
being merged.
For total CNs the probe signals for the two alleles are combined
(=summed; not averaged) on the intensity scale before fitting
underlying SnpPlm model, again with or without the strands
first being merged.
Methods
Methods:
getCellIndices | - | |
getChipEffectSet | - | |
getCombineAlleles | - | |
getProbeAffinityFile | - | |
setCombineAlleles | - |
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from Interface:
extend, print, uses
Requirements
Classes inheriting from this Interface must provide the
following fields, in addition to the ones according to SnpPlm:
- combineAlleles
A
logicalindicating if total or allele-specific copy numbers should be estimated according to the above averaging.
Author(s)
Henrik Bengtsson
The CnProbeAffinityFile class
Description
Package: aroma.affymetrix
Class CnProbeAffinityFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ProbeAffinityFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpProbeAffinityFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnProbeAffinityFile
Directly known subclasses:
public abstract static class CnProbeAffinityFile
extends SnpProbeAffinityFile
This class represents estimates of probe affinities in SNP probe-level models.
Usage
CnProbeAffinityFile(..., combineAlleles=FALSE)
Arguments
... |
Arguments passed to |
combineAlleles |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from SnpProbeAffinityFile:
getCellIndices, setMergeStrands
Methods inherited from ProbeAffinityFile:
as.character, getCellIndices, getParameters, readUnits
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The CnagCfhFile class
Description
Package: aroma.affymetrix
Class CnagCfhFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnagCfhFile
Directly known subclasses:
public abstract static class CnagCfhFile
extends AffymetrixFile
A CnagCfhFile object represents a single CNAG CFH file.
Usage
CnagCfhFile(..., cdf=NULL)
Arguments
... |
Arguments passed to |
cdf |
An optional |
Fields and Methods
Methods:
getCdf | Gets the CDF structure for this CEL file. | |
nbrOfCells | - | |
nbrOfSnps | - | |
setCdf | Sets the CDF structure for this CEL file. |
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically part of an CnagCfhSet.
Defines an CnagCfhFile object from a CFH file
Description
Defines an CnagCfhFile object from a CFH file.
Usage
## Static method (use this):
## CnagCfhFile$fromFile(filename, path=NULL, ..., verbose=FALSE, .checkArgs=TRUE)
## Don't use the below:
## S3 method for class 'CnagCfhFile'
fromFile(static, filename, path=NULL, ..., verbose=FALSE, .checkArgs=TRUE)
Arguments
filename |
The filename of to the file. |
path |
The path to the file. |
... |
Not used. |
Value
Returns an CnagCfhFile object.
If the file is not found or if it is of the wrong file format, an
error is thrown.
See Also
For more information see CnagCfhFile.
The CnagCfhSet class
Description
Package: aroma.affymetrix
Class CnagCfhSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CnagCfhSet
Directly known subclasses:
public static class CnagCfhSet
extends GenericDataFileSet
An CnagCfhSet object represents a set of CNAG CFH files with identical chip types.
Usage
CnagCfhSet(files=NULL, ...)
Arguments
files |
A |
... |
Not used. |
Fields and Methods
Methods:
as | - | |
as.CnagCfhSet | Coerce an object to an CnagCfhSet object. | |
byName | - | |
getAverage | - | |
getAverageAsinh | - | |
getAverageFile | Calculates the mean and the standard deviation of the cell signal (intensity, standard deviation etc.) across the CFH set. | |
getAverageLog | - | |
getCdf | Gets the CDF structure for this CFH set. | |
getData | - | |
getTimestamps | - | |
readUnits | - | |
setCdf | Sets the CDF structure for this CFH set. |
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
The CrlmmParametersFile class
Description
Package: aroma.affymetrix
Class CrlmmParametersFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--ColumnNamesInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--GenericTabularFile
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaTabularBinaryFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaUnitSignalBinaryFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CrlmmParametersFile
Directly known subclasses:
public static class CrlmmParametersFile
extends AromaUnitSignalBinaryFile
An CrlmmParametersFile is a AromaUnitSignalBinaryFile.
Usage
CrlmmParametersFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
allocate | - | |
findUnitsTodo | - | |
readParameter | - | |
updateParameter | - |
Methods inherited from AromaUnitSignalBinaryFile:
allocate, allocateFromUnitAnnotationDataFile, allocateFromUnitNamesFile, as.character, extractMatrix, extractRawGenomicSignals, fromFile, getChipType, getExtensionPattern, getFilenameExtension, getNumberOfFilesAveraged, getPlatform, isAverageFile, nbrOfUnits, readDataFrame, writeDataFrame
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaTabularBinaryFile:
[, [<-, [[, allocate, as.character, colApply, colMeans, colStats, colSums, dimnames<-, getBytesPerColumn, getColClasses, getDefaultColumnNames, getRootName, importFrom, nbrOfColumns, nbrOfRows, readColumns, readDataFrame, readFooter, readHeader, readRawFooter, setAttributesByTags, subset, summary, updateData, updateDataColumn, writeFooter, writeRawFooter
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericTabularFile:
[, as.character, dim, extractMatrix, head, nbrOfColumns, nbrOfRows, readColumns, readDataFrame, tail, writeColumnsToFiles
Methods inherited from ColumnNamesInterface:
appendColumnNamesTranslator, appendColumnNamesTranslatorByNULL, appendColumnNamesTranslatorBycharacter, appendColumnNamesTranslatorByfunction, appendColumnNamesTranslatorBylist, clearColumnNamesTranslator, clearListOfColumnNamesTranslators, getColumnNames, getColumnNamesTranslator, getDefaultColumnNames, getListOfColumnNamesTranslators, nbrOfColumns, setColumnNames, setColumnNamesTranslator, setListOfColumnNamesTranslators, updateColumnNames
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The CrlmmParametersSet class
Description
Package: aroma.affymetrix
Class CrlmmParametersSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--GenericTabularFileSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaTabularBinarySet
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaUnitSignalBinarySet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CrlmmParametersSet
Directly known subclasses:
public static class CrlmmParametersSet
extends AromaUnitSignalBinarySet
An CrlmmParametersSet object represents a set of
CrlmmParametersFiles with identical chip types.
Usage
CrlmmParametersSet(...)
Arguments
... |
Arguments passed to
|
Fields and Methods
Methods:
byName | - | |
byPath | - | |
findUnitsTodo | - |
Methods inherited from AromaUnitSignalBinarySet:
byName, findByName, getAromaFullNameTranslatorSet, getAromaUgpFile, getChipType, getPlatform, validate, writeDataFrame
Methods inherited from AromaTabularBinarySet:
getDefaultFullName, getRootName, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, setAttributesByTags
Methods inherited from GenericTabularFileSet:
extractMatrix, calculateAverageColumnAcrossFiles
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The DChipCdfBinFile class
Description
Package: aroma.affymetrix
Class DChipCdfBinFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitAnnotationDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitNamesFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--DChipCdfBinFile
Directly known subclasses:
public abstract static class DChipCdfBinFile
extends UnitNamesFile
A DChipCdfBinFile object represents a DChip CDF.bin file.
Usage
DChipCdfBinFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
byChipType | - | |
getChipType | - | |
getFileFormat | - | |
getHeader | - | |
getPlatform | - | |
getUnitNames | - | |
getUnitSizes | - | |
nbrOfCells | - | |
nbrOfUnits | - | |
readDataFrame | - |
Methods inherited from UnitNamesFile:
getUnitNames, indexOf, nbrOfUnits
Methods inherited from UnitAnnotationDataFile:
byChipType, getAromaUflFile, getAromaUgpFile, getChipType, getDefaultExtension, getPlatform, nbrOfUnits
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The DChipDcpFile class
Description
Package: aroma.affymetrix
Class DChipDcpFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--DChipDcpFile
Directly known subclasses:
public abstract static class DChipDcpFile
extends AffymetrixFile
A DChipDcpFile object represents a DChip DCP file.
Usage
DChipDcpFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
dim | - | |
extractTheta | - | |
getCalls | - | |
getExcludes | - | |
getFileFormat | - | |
getHeader | - | |
getNormalizedIntensities | - | |
getRawIntensities | - | |
getThetaStds | - | |
getThetas | - | |
getThetasAB | - | |
hasMbeiData | - | |
hasNormalizedData | - | |
nbrOfCells | - | |
nbrOfUnits | - |
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
The DChipDcpSet class
Description
Package: aroma.affymetrix
Class DChipDcpSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--DChipDcpSet
Directly known subclasses:
public abstract static class DChipDcpSet
extends AffymetrixFileSet
A DChipDcpSet object represents a set of DChip DCP files for identical chip types.
Usage
DChipDcpSet(files=NULL, ...)
Arguments
files |
A |
... |
Not used. |
Fields and Methods
Methods:
as | - | |
as.DChipDcpSet | Coerce an object to an DChipDcpSet object. | |
byName | - | |
exportTotalAndFracB | - | |
extractTheta | - | |
getCdfBin | - | |
getChipType | - |
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
The DChipGenomeInformation class
Description
Package: aroma.affymetrix
Class DChipGenomeInformation
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--GenomeInformation
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--DChipGenomeInformation
Directly known subclasses:
public abstract static class DChipGenomeInformation
extends GenomeInformation
This class represents dChip genome information files, which typically contains information about chromosomal locations of the units.
Usage
DChipGenomeInformation(...)
Arguments
... |
Arguments passed to |
Details
The dChip genome information files for various chip types can be
downloaded from https://sites.google.com/site/dchipsoft/.
Put each file in a
directory named identically as the corresponding chip type under the
annotations/ directory, e.g.
annotations/Mapping50K_Hind240/50k hind genome info AfAm
june 05 hg17.xls.
Note that dChip changes the filename and file format slightly between
chip types, but currently the *byChipType() basically searches
for files with names consisting of "genome info" or
"genome_info". At least for the most common chip types, there
is no need to rename the files in order for this class to recognize them.
Fields and Methods
Methods:
byChipType | Defines a DChipGenomeInformation object by chip type. | |
readDataFrame | - |
Methods inherited from GenomeInformation:
as.character, byChipType, fromCdf, fromDataSet, getChipType, getChromosomeStats, getChromosomes, getData, getPositions, getUnitIndices, getUnitsOnChromosome, getUnitsOnChromosomes, isCompatibleWithCdf, nbrOfUnits, plotDensity, readDataFrame, verify
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The DChipQuantileNormalization class
Description
Package: aroma.affymetrix
Class DChipQuantileNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--QuantileNormalization
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--DChipQuantileNormalization
Directly known subclasses:
public static class DChipQuantileNormalization
extends QuantileNormalization
This class represents a special QuantileNormalization
using smooth-splines.
Usage
DChipQuantileNormalization(..., robust=FALSE)
Arguments
... |
Arguments passed to the constructor of
|
robust |
If |
Details
This normalization method implements the two-pass algorithm described in Bengtsson et al. (2008).
Fields and Methods
Methods:
process | Normalizes the data set. |
Methods inherited from QuantileNormalization:
findTargetDistributionFile, getParameters, process
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
References
[1] H. Bengtsson, R. Irizarry, B. Carvalho, & T.P. Speed. Estimation and assessment of raw copy numbers at the single locus level, Bioinformatics, 2008.
The DChipSnpInformation class
Description
Package: aroma.affymetrix
Class DChipSnpInformation
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--SnpInformation
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--DChipSnpInformation
Directly known subclasses:
public abstract static class DChipSnpInformation
extends SnpInformation
This class represents dChip genome information files, which typically contains information on nucleotide sequences and fragment lengths of the units.
Usage
DChipSnpInformation(...)
Arguments
... |
Arguments passed to |
Details
The dChip SNP information files for various chip types can be
downloaded from https://sites.google.com/site/dchipsoft/.
Put each file in a
directory named identically as the corresponding chip type under the
annotations/ directory, e.g.
annotations/Mapping50K_Hind240/50k hind snp info AfAm
june 05 hg17.xls.
Note that dChip changes the filename and file format slightly between
chip types, but currently the *byChipType() basically searches
for files with names consisting of "snp info" or
"snp_info". At least for the most common chip types, there
is no need to rename the files in order for this class to recognize them.
Fields and Methods
Methods:
byChipType | Defines a DChipSnpInformation object by chip type. | |
readDataFrame | - |
Methods inherited from SnpInformation:
as.character, byChipType, fromCdf, fromDataSet, getChipType, getData, getFields, getFragmentLengths, getFragmentStarts, getFragmentStops, isCompatibleWithCdf, nbrOfEnzymes, nbrOfUnits, readDataFrame, verify
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The ExonChipEffectFile class
Description
Package: aroma.affymetrix
Class ExonChipEffectFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ExonChipEffectFile
Directly known subclasses:
public abstract static class ExonChipEffectFile
extends ChipEffectFile
This class represents estimates of chip effects in the probe-level models.
Usage
ExonChipEffectFile(..., mergeGroups=FALSE)
Arguments
... |
Arguments passed to |
mergeGroups |
Specifies if the groups are merged or not for these estimates. |
Fields and Methods
Methods:
readUnits | - |
Methods inherited from ChipEffectFile:
as.character, extractChromosomalDataFrame, extractMatrix, extractTheta, findUnitsTodo, getAM, getAsFullCelFile, getCellIndices, getCellMapForMainCdf, getExpandedCellMap, getParameters, getUnitGroupCellArrayMap, getUnitGroupCellMatrixMap, getXAM, mergeGroups, readUnits, writeAsFullCelFile
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
See Also
An object of this class is typically part of a ExonChipEffectSet.
The ExonChipEffectSet class
Description
Package: aroma.affymetrix
Class ExonChipEffectSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ExonChipEffectSet
Directly known subclasses:
public static class ExonChipEffectSet
extends ChipEffectSet
This class represents estimates of chip effects in the probe-level models.
Usage
ExonChipEffectSet(..., mergeGroups=TRUE)
Arguments
... |
Arguments passed to |
mergeGroups |
Specifies if groups (individual exons in a CDF file) are merged or not for these estimates, i.e. whether transcript-level expression is to be estimated. |
Fields and Methods
Methods:
findUnitsTodo | - | |
getAverageFile | - | |
getMergeGroups | - | |
setMergeGroups | - |
Methods inherited from ChipEffectSet:
as.character, boxplotStats, byPath, calculateBaseline, calculateFieldBoxplotStats, calculateNuseBoxplotStats, calculateRleBoxplotStats, extractAffyBatch, extractChromosomalDataFrame, extractExpressionSet, extractMatrix, extractTheta, findByName, findUnitsTodo, fromDataSet, getAM, getAsFullCelSet, getAverageFile, getBaseline, getCellIndices, getXAM, plotBoxplot, readUnits, updateUnits
Methods inherited from ParameterCelSet:
extractDataFrame, extractMatrix
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
The ExonProbeAffinityFile class
Description
Package: aroma.affymetrix
Class ExonProbeAffinityFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ProbeAffinityFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ExonProbeAffinityFile
Directly known subclasses:
public abstract static class ExonProbeAffinityFile
extends ProbeAffinityFile
This class represents estimates of probe affinities in exon array probe-level models.
Usage
ExonProbeAffinityFile(..., mergeGroups=FALSE)
Arguments
... |
Arguments passed to |
mergeGroups |
Specifies if the groups (exons) are merged or not for these estimates. |
Fields and Methods
Methods:
No methods defined.
Methods inherited from ProbeAffinityFile:
as.character, getCellIndices, getParameters, readUnits
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
The ExonRmaPlm class
Description
Package: aroma.affymetrix
Class ExonRmaPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ExonRmaPlm
Directly known subclasses:
public abstract static class ExonRmaPlm
extends RmaPlm
This class represents the log-additive model part of the Robust Multichip Analysis (RMA) method described in Irizarry et al (2003), as implemented for exon arrays. The model may be fitted with exons merged into transcripts (all probes fitted together) or on an individual exon basis (probes within an exon treated as a group, but exons fitted separately).
Usage
ExonRmaPlm(..., mergeGroups=TRUE)
Arguments
... |
Arguments passed to |
mergeGroups |
A |
Fields and Methods
Methods:
getCellIndices | - | |
getChipEffectSet | - | |
getProbeAffinityFile | - | |
setMergeGroups | - |
Methods inherited from RmaPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, getRlmFitFunctions
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Model
Author(s)
Ken Simpson, Henrik Bengtsson, Elizabeth Purdom
References
Irizarry et al. Summaries of Affymetrix GeneChip probe level data.
NAR, 2003, 31, e15.
The FirmaFile class
Description
Package: aroma.affymetrix
Class FirmaFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--FirmaFile
Directly known subclasses:
public abstract static class FirmaFile
extends ParameterCelFile
This class represents scores calculated by the FIRMA algorithm.
Usage
FirmaFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
extractMatrix | - | |
findUnitsTodo | - | |
readUnits | - |
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
See Also
An object of this class is typically part of a FirmaSet.
The FirmaModel class
Description
Package: aroma.affymetrix
Class FirmaModel
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FirmaModel
Directly known subclasses:
public abstract static class FirmaModel
extends UnitModel
This class represents the FIRMA (Finding Isoforms using RMA) alternative splicing model.
Usage
FirmaModel(rmaPlm=NULL, summaryMethod=c("median", "upperQuartile", "max"),
operateOn=c("residuals", "weights"), ...)
Arguments
rmaPlm |
An @RmaPlm object. |
summaryMethod |
A |
operateOn |
A |
... |
Arguments passed to constructor of |
Fields and Methods
Methods:
fit | Estimates the model parameters. | |
getCdf | - | |
getDataSet | - | |
getFirmaSet | Gets the set of FIRMA results for this model. | |
getName | - | |
getPlm | - | |
getTags | - |
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
The FirmaSet class
Description
Package: aroma.affymetrix
Class FirmaSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--FirmaSet
Directly known subclasses:
public static class FirmaSet
extends ParameterCelSet
Usage
FirmaSet(...)
Arguments
... |
Arguments passed to constructor of |
Fields and Methods
Methods:
extractMatrix | - | |
findUnitsTodo | - | |
getCellIndices | - | |
readUnits | - |
Methods inherited from ParameterCelSet:
extractDataFrame, extractMatrix
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
The FragmentEquivalentClassNormalization class
Description
Package: aroma.affymetrix
Class FragmentEquivalentClassNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--FragmentEquivalentClassNormalization
Directly known subclasses:
public static class FragmentEquivalentClassNormalization
extends ChipEffectTransform
This class represents a normalization method that corrects for systematic effects between loci of different equivalent classes of pairs of sequences that are recognized by the restriction enzymes that cut the DNA studies.
Usage
FragmentEquivalentClassNormalization(dataSet=NULL, ..., targetAvgs=NULL,
subsetToFit="-XY")
Arguments
dataSet |
|
... |
Additional arguments passed to the constructor of
|
targetAvgs |
An optional list of |
subsetToFit |
The units from which the normalization curve should
be estimated. If |
Fields and Methods
Methods:
getAromaUfcFile | - | |
getCdf | - | |
process | Normalizes the data set. |
Methods inherited from ChipEffectTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Requirements
This class requires an UFC (Unit Fragment Class) annotation file.
Acknowledgments
The idea of normalization signals stratified on enzyme recognition sequences is credited to Jim Veitch and Ben Bolstad at Affymetrix Inc. (2008) who have designed a similar method for copy number estimation in the Affymetrix' Genotype Console v2.
Author(s)
Henrik Bengtsson
The FragmentLengthNormalization class
Description
Package: aroma.affymetrix
Class FragmentLengthNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--FragmentLengthNormalization
Directly known subclasses:
public static class FragmentLengthNormalization
extends ChipEffectTransform
This class represents a normalization method that corrects for PCR fragment length effects on copy-number chip-effect estimates.
Usage
FragmentLengthNormalization(dataSet=NULL, ..., target=targetFunctions, subsetToFit="-XY",
lengthRange=NULL, onMissing=c("median", "ignore"), shift=0, targetFunctions=NULL)
Arguments
dataSet |
|
... |
Additional arguments passed to the constructor of
|
target |
(Optional) A |
subsetToFit |
The units from which the normalization curve should
be estimated. If |
lengthRange |
If given, a |
onMissing |
Specifies how to normalize units for which the fragment lengths are unknown. |
shift |
An optional amount the data points should be shifted (translated). |
targetFunctions |
Deprecated. |
Details
For SNPs, the normalization function is estimated based on the total chip effects, i.e. the sum of the allele signals. The normalizing is done by rescale the chip effects on the intensity scale such that the mean of the total chip effects are the same across samples for any given fragment length. For allele-specific estimates, both alleles are always rescaled by the same amount. Thus, when normalizing allele-specific chip effects, the total chip effects is change, but not the relative allele signal, e.g. the allele B frequency.
Fields and Methods
Methods:
getCdf | - | |
process | Normalizes the data set. |
Methods inherited from ChipEffectTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Requirements
This class requires a SNP information annotation file for the chip type to be normalized.
Author(s)
Henrik Bengtsson
The GcContentNormalization class
Description
Package: aroma.affymetrix
Class GcContentNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--GcContentNormalization
Directly known subclasses:
public static class GcContentNormalization
extends ChipEffectTransform
Usage
GcContentNormalization(dataSet=NULL, ..., targetFunction=NULL, subsetToFit=NULL)
Arguments
dataSet |
|
... |
Additional arguments passed to the constructor of
|
targetFunction |
A |
subsetToFit |
The units from which the normalization curve should
be estimated. If |
Fields and Methods
Methods:
getCdf | - | |
process | Normalizes the data set. |
Methods inherited from ChipEffectTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Requirements
This class requires an Aroma unit GC-content (UGC) file.
Author(s)
Henrik Bengtsson
The GcContentNormalization2 class
Description
Package: aroma.affymetrix
Class GcContentNormalization2
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AdditiveCovariatesNormalization
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--GcContentNormalization2
Directly known subclasses:
public static class GcContentNormalization2
extends AdditiveCovariatesNormalization
This class represents a normalization method that corrects for annotation-data covariate effects on copy-number chip-effect estimates.
Usage
GcContentNormalization2(...)
Arguments
... |
Arguments passed to the constructor of
|
Fields and Methods
Methods:
plotCovariateEffects | - |
Methods inherited from AdditiveCovariatesNormalization:
getAsteriskTags, getCdf, getCovariates, getOutputDataSet00, getParameters, process
Methods inherited from ChipEffectTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The GcRmaBackgroundCorrection class
Description
Package: aroma.affymetrix
Class GcRmaBackgroundCorrection
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--BackgroundCorrection
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--GcRmaBackgroundCorrection
Directly known subclasses:
public static class GcRmaBackgroundCorrection
extends BackgroundCorrection
This class represents the GCRMA background adjustment function.
Usage
GcRmaBackgroundCorrection(..., indicesNegativeControl=NULL, affinities=NULL,
type=c("fullmodel", "affinities"), opticalAdjust=TRUE, gsbAdjust=TRUE,
gsbParameters=NULL, seed=NULL)
Arguments
... |
Arguments passed to the constructor of
|
indicesNegativeControl |
Locations of any negative control
probes (e.g., the anti-genomic controls on the human exon array).
If |
affinities |
A |
type |
Type (flavor) of background correction, which can
be either |
gsbAdjust |
If |
opticalAdjust |
If |
gsbParameters |
Additional argument passed to the internal
|
seed |
An (optional) |
Fields and Methods
Methods:
process | Performs background correction. |
Methods inherited from BackgroundCorrection:
getParameters, process
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
References
[1] Z. Wu, R. Irizarry, R. Gentleman, F.M. Murillo & F. Spencer.
A Model Based Background Adjustment for Oligonucleotide
Expression Arrays, JASA, 2004.
The GenericReporter class
Description
Package: aroma.affymetrix
Class GenericReporter
Object
~~|
~~+--GenericReporter
Directly known subclasses:
AffymetrixCelSetReporter, AffymetrixFileSetReporter, SpatialReporter
public abstract static class GenericReporter
extends Object
Usage
GenericReporter(tags="*", ...)
Arguments
tags |
|
... |
Not used. |
Fields and Methods
Methods:
getFullName | - | |
getName | Gets the name of the explorer. | |
getPath | - | |
getTags | Gets the tags of the reporter. | |
process | Generates report. | |
setup | - |
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The GenomeInformation class
Description
Package: aroma.affymetrix
Class GenomeInformation
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--GenomeInformation
Directly known subclasses:
AffymetrixCsvGenomeInformation, DChipGenomeInformation, UgpGenomeInformation
public abstract static class GenomeInformation
extends FileCacheKeyInterface
Usage
GenomeInformation(..., .verify=TRUE)
Arguments
... |
Arguments passed to |
.verify |
For internal use only. |
Fields and Methods
Methods:
byChipType | Static method to define a genome information set by chip type. | |
getChipType | Gets the chip type of this genome information set. | |
getChromosomeStats | - | |
getChromosomes | - | |
getData | Gets all or a subset of the genome information data. | |
getPositions | Gets the physical positions for a set of units. | |
getUnitsOnChromosome | - | |
getUnitsOnChromosomes | - | |
nbrOfUnits | - | |
plotDensity | Plots the density of SNPs for a given chromosome. |
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Static method to define a genome information set by chip type
Description
Static method to define a genome information set by chip type.
Usage
## Static method (use this):
## GenomeInformation$byChipType()
## Don't use the below:
## S3 method for class 'GenomeInformation'
byChipType(...)
Arguments
... |
Not used. |
Value
Returns a GenomeInformation object.
See Also
For more information see GenomeInformation.
Static method to define a genome information set from a CDF
Description
Static method to define a genome information set from a CDF.
Usage
## Static method (use this):
## GenomeInformation$fromCdf(cdf, ...)
## Don't use the below:
## S3 method for class 'GenomeInformation'
fromCdf(static, cdf, ...)
Arguments
cdf |
|
... |
Additional argument passed to |
Value
Returns a GenomeInformation object.
See Also
*byChipType().
For more information see GenomeInformation.
The HetLogAddCnPlm class
Description
Package: aroma.affymetrix
Class HetLogAddCnPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--HetLogAddPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--HetLogAddSnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--HetLogAddCnPlm
Directly known subclasses:
public abstract static class HetLogAddCnPlm
extends CnPlm
Usage
HetLogAddCnPlm(..., combineAlleles=FALSE)
Arguments
... |
Arguments passed to |
combineAlleles |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from CnPlm:
getCellIndices, getChipEffectSet, getCombineAlleles, getParameters, getProbeAffinityFile, setCombineAlleles
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from HetLogAddSnpPlm:
getAsteriskTags
Methods inherited from HetLogAddPlm:
getAsteriskTags, getFitUnitGroupFunction
Methods inherited from RmaPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, getRlmFitFunctions
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Model
TO DO.
Author(s)
Henrik Bengtsson
The HetLogAddPlm class
Description
Package: aroma.affymetrix
Class HetLogAddPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--HetLogAddPlm
Directly known subclasses:
HetLogAddCnPlm, HetLogAddSnpPlm
public abstract static class HetLogAddPlm
extends RmaPlm
This class represents a log-additive model similar to the one described in Irizarry et al (2003), except that the errors may have different variances for different probes.
Usage
HetLogAddPlm(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
No methods defined.
Methods inherited from RmaPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, getRlmFitFunctions
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
The HetLogAddSnpPlm class
Description
Package: aroma.affymetrix
Class HetLogAddSnpPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--HetLogAddPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--HetLogAddSnpPlm
Directly known subclasses:
HetLogAddCnPlm
public abstract static class HetLogAddSnpPlm
extends SnpPlm
Usage
HetLogAddSnpPlm(..., mergeStrands=FALSE)
Arguments
... |
Arguments passed to |
mergeStrands |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from HetLogAddPlm:
getAsteriskTags, getFitUnitGroupFunction
Methods inherited from RmaPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, getRlmFitFunctions
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The LimmaBackgroundCorrection class
Description
Package: aroma.affymetrix
Class LimmaBackgroundCorrection
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--BackgroundCorrection
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--LimmaBackgroundCorrection
Directly known subclasses:
NormExpBackgroundCorrection
public static class LimmaBackgroundCorrection
extends BackgroundCorrection
This class represents the various "background" correction methods implemented in the limma package.
Usage
LimmaBackgroundCorrection(..., args=NULL, addJitter=FALSE, jitterSd=0.2, seed=6022007)
Arguments
... |
Arguments passed to the constructor of
|
args |
A |
addJitter |
If |
jitterSd |
Standard deviation of the jitter noise added. |
seed |
An (optional) |
Details
By default, only PM signals are background corrected and MMs are left unchanged.
Fields and Methods
Methods:
process | Performs background correction. |
Methods inherited from BackgroundCorrection:
getParameters, process
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Jitter noise
The fitting algorithm of the normal+exponential background correction model may not converge if there too many small and discrete signals. To overcome this problem, a small amount of noise may be added to the signals before fitting the model. This is an ad hoc solution that seems to work. However, adding Gaussian noise may generate non-positive signals.
Author(s)
Henrik Bengtsson. Adopted from RmaBackgroundCorrection by Ken Simpson.
See Also
Internally, backgroundCorrect is used.
The LinearModelProbeSequenceNormalization class
Description
Package: aroma.affymetrix
Class LinearModelProbeSequenceNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AbstractProbeSequenceNormalization
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--LinearModelProbeSequenceNormalization
Directly known subclasses:
BasePositionNormalization
public abstract static class LinearModelProbeSequenceNormalization
extends AbstractProbeSequenceNormalization
This abstract class represents a normalization method that corrects for systematic effects in the probe intensities due to probe-sequence dependent effects that can be modeled using a linear model.
Usage
LinearModelProbeSequenceNormalization(...)
Arguments
... |
Arguments passed to the constructor of
|
Fields and Methods
Methods:
No methods defined.
Methods inherited from AbstractProbeSequenceNormalization:
fitOne, getAromaCellSequenceFile, getParameters, getTargetFile, indexOfMissingSequences, predictOne, process
Methods inherited from ProbeLevelTransform3:
getAsteriskTags, getCellsTo, getCellsToFit, getCellsToUpdate, getParameters, getUnitsTo, getUnitsToFit, getUnitsToUpdate, writeSignals
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Requirements
This class requires that an aroma probe sequence file is available for the chip type.
Memory usage
The model fitting methods of this class are bounded in memory.
This is done by first building up the normal equations incrementally
in chunks of cells. The generation of normal equations is otherwise
the step that consumes the most memory.
When the normal equations are available, the solve()
method is used to solve the equations. Note that this algorithm is
still exact.
Author(s)
Henrik Bengtsson
The MatNormalization class
Description
Package: aroma.affymetrix
Class MatNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AbstractProbeSequenceNormalization
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--MatNormalization
Directly known subclasses:
public static class MatNormalization
extends AbstractProbeSequenceNormalization
This class represents a normalization method that corrects for systematic effects in the probe intensities due to differences in the number of A, C, G, and T:s and the match scores according to MAT [1].
Usage
MatNormalization(..., unitsToFit=NULL, model=c("lm"), nbrOfBins=200)
Arguments
... |
Arguments passed to the constructor of
|
unitsToFit |
The units from which the normalization curve should
be estimated. If |
model |
A |
nbrOfBins |
The number of bins to use for the variance smoothing step. |
Fields and Methods
Methods:
process | Normalizes the data set. |
Methods inherited from AbstractProbeSequenceNormalization:
fitOne, getAromaCellSequenceFile, getParameters, getTargetFile, indexOfMissingSequences, predictOne, process
Methods inherited from ProbeLevelTransform3:
getAsteriskTags, getCellsTo, getCellsToFit, getCellsToUpdate, getParameters, getUnitsTo, getUnitsToFit, getUnitsToUpdate, writeSignals
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Requirements
This class requires that an aroma probe sequence file and aroma match scores file is available for the chip type.
Author(s)
Mark Robinson
References
[1] Johnson WE, Li W, Meyer CA, Gottardo R, Carroll JS, Brown M, Liu XS. Model-based analysis of tiling-arrays for ChIP-chip, PNAS, 2006.
The MatSmoothing class
Description
Package: aroma.affymetrix
Class MatSmoothing
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--MatSmoothing
Directly known subclasses:
public static class MatSmoothing
extends ProbeLevelTransform
This class represents a function for smoothing data with a trimmed mean.
Usage
MatSmoothing(..., design=NULL, probeWindow=300, nProbes=10, meanTrim=0.1)
Arguments
... |
Arguments passed to |
design |
A design |
probeWindow |
Bandwidth to use. Effectively the width is 2*probeWindow since it looks probeWindow bases in either direction. |
nProbes |
The minimum number of probes to calculate a MAT score for. |
meanTrim |
The amount of trimming of the mean in [0,0.5]. |
Details
This class requires the gsmoothr package, which was archived on CRAN in May 2025.
Fields and Methods
Methods:
process | Processes the data set. |
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Mark Robinson, Henrik Bengtsson
The MbeiCnPlm class
Description
Package: aroma.affymetrix
Class MbeiCnPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--MbeiPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--MbeiSnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--MbeiCnPlm
Directly known subclasses:
public abstract static class MbeiCnPlm
extends CnPlm
Usage
MbeiCnPlm(..., combineAlleles=FALSE)
Arguments
... |
Arguments passed to |
combineAlleles |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from CnPlm:
getCellIndices, getChipEffectSet, getCombineAlleles, getParameters, getProbeAffinityFile, setCombineAlleles
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from MbeiSnpPlm:
getAsteriskTags
Methods inherited from MbeiPlm:
getAsteriskTags, getFitUnitGroupFunction
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The MbeiPlm class
Description
Package: aroma.affymetrix
Class MbeiPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--MbeiPlm
Directly known subclasses:
MbeiCnPlm, MbeiSnpPlm
public abstract static class MbeiPlm
extends ProbeLevelModel
This class represents the model-based expression indexes (MBEI) multiplicative model in Li & Wong (2001).
Usage
MbeiPlm(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
No methods defined.
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Model
For a single unit group, the multiplicative model is:
y_{ik} = \theta_i \phi_k + \varepsilon_{ik}
where \theta_i are the chip effects for arrays i=1,...,I,
and \phi_k are the probe affinities for probes k=1,...,K.
The \varepsilon_{ik} are zero-mean noise with equal variance.
To make to parameters identifiable, the constraint
\prod_k \phi_k = 1 is added.
Author(s)
Henrik Bengtsson
References
Li, C. and Wong, W.H. (2001), Genome Biology 2, 1-11.
Li, C. and Wong, W.H. (2001), Proc. Natl. Acad. Sci USA 98, 31-36.
See Also
Internally fit.li.wong is used.
The MbeiSnpPlm class
Description
Package: aroma.affymetrix
Class MbeiSnpPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--MbeiPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--MbeiSnpPlm
Directly known subclasses:
MbeiCnPlm
public abstract static class MbeiSnpPlm
extends SnpPlm
Usage
MbeiSnpPlm(..., mergeStrands=FALSE)
Arguments
... |
Arguments passed to |
mergeStrands |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from MbeiPlm:
getAsteriskTags, getFitUnitGroupFunction
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The Model class
Description
Package: aroma.affymetrix
Class Model
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
Directly known subclasses:
AffineCnPlm, AffinePlm, AffineSnpPlm, AlleleSummation, AvgCnPlm, AvgPlm, AvgSnpPlm, CrlmmModel, ExonRmaPlm, FirmaModel, HetLogAddCnPlm, HetLogAddPlm, HetLogAddSnpPlm, MbeiCnPlm, MbeiPlm, MbeiSnpPlm, MultiArrayUnitModel, ProbeLevelModel, RmaCnPlm, RmaPlm, RmaSnpPlm, SingleArrayUnitModel, UnitModel
public abstract static class Model
extends ParametersInterface
This class is abstract and represents a generic model that applies to a data set.
Usage
Model(dataSet=NULL, tags="*", ..., .onUnknownArgs=c("error", "warning", "ignore"))
Arguments
dataSet |
The data set to which this model should be fitted. |
tags |
A |
... |
Not used. |
.onUnknownArgs |
A |
Fields and Methods
Methods:
fit | Estimates the model parameters. | |
getAsteriskTags | - | |
getDataSet | Gets the input data set for this model. | |
getFullName | Gets the full name of the output set. | |
getName | Gets the name of the output data set. | |
getPath | Gets the path of this model. | |
getTags | Gets the tags of the output data set. | |
setTags | Sets the tags to be appended. |
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The MultiArrayUnitModel class
Description
Package: aroma.affymetrix
Class MultiArrayUnitModel
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
Directly known subclasses:
AffineCnPlm, AffinePlm, AffineSnpPlm, AvgCnPlm, AvgPlm, AvgSnpPlm, ExonRmaPlm, HetLogAddCnPlm, HetLogAddPlm, HetLogAddSnpPlm, MbeiCnPlm, MbeiPlm, MbeiSnpPlm, ProbeLevelModel, RmaCnPlm, RmaPlm, RmaSnpPlm
public abstract static class MultiArrayUnitModel
extends UnitModel
This abstract class represents a unit model that fits one model per unit based on signals for all arrays in the data set. The nature of a multi-array unit model is that all arrays must be available at the time of the fit and the estimated parameters will depend on the data from all arrays. Thus, if the signals in one array changes the model has to be refitted.
Usage
MultiArrayUnitModel(..., listOfPriors=NULL)
Arguments
... |
Arguments passed to |
listOfPriors |
A |
Fields and Methods
Methods:
getListOfPriors | - | |
setListOfPriors | - |
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Static method to get the low-level function that fits the PLM
Description
Static method to get the low-level function that fits the PLM.
Any subclass model must provide this method, which should return
a function that accepts an IxK matrix.
Usage
## Static method (use this):
## MultiArrayUnitModel$getFitUnitGroupFunction()
## Don't use the below:
## S3 method for class 'MultiArrayUnitModel'
getFitUnitGroupFunction(...)
Arguments
... |
Not used. |
Value
Returns a function.
See Also
For more information see MultiArrayUnitModel.
Non-documented objects
Description
This page contains aliases for all "non-documented" objects that
R CMD check detects in this package.
Almost all of them are generic functions that have specific
document for the corresponding method coupled to a specific class.
Other functions are re-defined by setMethodS3() to
default methods. Neither of these two classes are non-documented
in reality.
The rest are deprecated methods.
The NormExpBackgroundCorrection class
Description
Package: aroma.affymetrix
Class NormExpBackgroundCorrection
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--BackgroundCorrection
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--LimmaBackgroundCorrection
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--NormExpBackgroundCorrection
Directly known subclasses:
public static class NormExpBackgroundCorrection
extends LimmaBackgroundCorrection
This class represents the normal exponential background correction model. Estimators of the limma package is used.
Usage
NormExpBackgroundCorrection(..., method=c("rma", "saddle", "mle"))
Arguments
... |
Arguments passed to the constructor of
|
method |
The estimator used, cf. argument |
Fields and Methods
Methods:
No methods defined.
Methods inherited from LimmaBackgroundCorrection:
getAsteriskTags, getParameters, process
Methods inherited from BackgroundCorrection:
getParameters, process
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
Internally, backgroundCorrect is used.
The OpticalBackgroundCorrection class
Description
Package: aroma.affymetrix
Class OpticalBackgroundCorrection
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--BackgroundCorrection
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--OpticalBackgroundCorrection
Directly known subclasses:
public static class OpticalBackgroundCorrection
extends BackgroundCorrection
This class represents "optical" background adjustment.
Usage
OpticalBackgroundCorrection(..., minimum=1)
Arguments
... |
Arguments passed to the constructor of
|
minimum |
The minimum signal allowed after adjustment. |
Fields and Methods
Methods:
process | Performs background correction. |
Methods inherited from BackgroundCorrection:
getParameters, process
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson
The ParameterCelFile class
Description
Package: aroma.affymetrix
Class ParameterCelFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
Directly known subclasses:
ChipEffectFile, CnChipEffectFile, CnProbeAffinityFile, ExonChipEffectFile, ExonProbeAffinityFile, FirmaFile, ProbeAffinityFile, ResidualFile, SnpChipEffectFile, SnpProbeAffinityFile, WeightsFile
public abstract static class ParameterCelFile
extends ParametersInterface
A ParameterCelFile object represents parameter estimates.
Usage
ParameterCelFile(..., encodeFunction=NULL, decodeFunction=NULL)
Arguments
... |
Arguments passed to |
encodeFunction |
|
decodeFunction |
Fields and Methods
Methods:
extractDataFrame | - | |
extractMatrix | - | |
readUnits | - |
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
File format
The idea behind this class is store data fields which by nature have one value per probe (per field) in CEL files. A perfect example is to store probe-affinity estimates and their standard deviations. There is one probe affinity per probe so the structure of a CEL file (and its coupled CDF file) is well suited to read/write such information.
Consider a unit group with L probes. A CEL file stores
intensities (L floats), stdvs (L floats), and
pixels (L integers). Thus, for each probe l=1,...,L, a
(float, float, integer) tuple is stored. We can use this for any
information we want. If we want a slightly different structure,
we can choose to encode/decode our structure/information to fit the
structure of the CEL file. This abstract class provides transparent
methods for encoding and decoding such information through methods
encodeUnitGroup() and decodeUnitGroup().
By subclassing you can implement different types of data structures.
Author(s)
Henrik Bengtsson
The ParameterCelSet class
Description
Package: aroma.affymetrix
Class ParameterCelSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelSet
Directly known subclasses:
ChipEffectSet, CnChipEffectSet, ExonChipEffectSet, FirmaSet, SnpChipEffectSet
public static class ParameterCelSet
extends ParametersInterface
A ParameterCelSet object represents a set of ParameterCelFile:s.
Usage
ParameterCelSet(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
extractDataFrame | Extract data as a data.frame for a set of arrays. | |
extractMatrix | Extract data as a matrix for a set of arrays. |
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The ProbeAffinityFile class
Description
Package: aroma.affymetrix
Class ProbeAffinityFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ProbeAffinityFile
Directly known subclasses:
CnProbeAffinityFile, ExonProbeAffinityFile, SnpProbeAffinityFile
public abstract static class ProbeAffinityFile
extends ParameterCelFile
This class represents estimates of probe affinities in probe-level models.
Usage
ProbeAffinityFile(..., probeModel=c("pm", "mm", "pm-mm", "min1(pm-mm)", "pm+mm"))
Arguments
... |
Arguments passed to |
probeModel |
The specific type of probe model. |
Fields and Methods
Methods:
readUnits | - |
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically obtained through the
getProbeAffinityFile() method for the ProbeLevelModel class.
The ProbeLevelModel class
Description
Package: aroma.affymetrix
Class ProbeLevelModel
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
Directly known subclasses:
AffineCnPlm, AffinePlm, AffineSnpPlm, AvgCnPlm, AvgPlm, AvgSnpPlm, ExonRmaPlm, HetLogAddCnPlm, HetLogAddPlm, HetLogAddSnpPlm, MbeiCnPlm, MbeiPlm, MbeiSnpPlm, RmaCnPlm, RmaPlm, RmaSnpPlm
public abstract static class ProbeLevelModel
extends MultiArrayUnitModel
This abstract class represents a probe-level model (PLM) as defined by the affyPLM package: "A [...] PLM is a model that is fit to probe-intensity data. More specifically, it is where we fit a model with probe level and chip level parameters on a probeset by probeset basis", where the more general case for a probeset is a unit group in Affymetrix CDF terms.
Usage
ProbeLevelModel(..., standardize=TRUE)
Arguments
... |
Arguments passed to |
standardize |
If |
Details
In order to minimize the risk for mistakes, but also to be able compare results from different PLMs, all PLM subclasses must meet the following criteria:
All parameter estimates must be (stored and returned) on the intensity scale, e.g. log-additive models such as
RmaPlmhave to transform the parameters on the log-scale to the intensity scale.The probe-affinity estimates
\phi_kfor a unit group must be constrained such that\prod_k \phi_k = 1, or equivalently if\phi_k > 0,\sum_k \log(\phi_k) = 0.
Note that the above probe-affinity constraint guarantees that the estimated chip effects across models are on the same scale.
Fields and Methods
Methods:
fit | Estimates the model parameters. | |
getChipEffectSet | Gets the set of chip effects for this model. | |
getProbeAffinityFile | Gets the probe affinities for this model. | |
getResidualSet | - | |
getWeightsSet | - |
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
For more details on probe-level models, please see the preprocessCore package.
The ProbeLevelTransform class
Description
Package: aroma.affymetrix
Class ProbeLevelTransform
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
Directly known subclasses:
AbstractProbeSequenceNormalization, AllelicCrosstalkCalibration, BackgroundCorrection, BaseCountNormalization, BasePositionNormalization, DChipQuantileNormalization, GcRmaBackgroundCorrection, LimmaBackgroundCorrection, LinearModelProbeSequenceNormalization, MatNormalization, MatSmoothing, NormExpBackgroundCorrection, OpticalBackgroundCorrection, ProbeLevelTransform3, QuantileNormalization, ReseqCrosstalkCalibration, RmaBackgroundCorrection, ScaleNormalization, ScaleNormalization3, SpatialRowColumnNormalization, UnitTypeScaleNormalization
public abstract static class ProbeLevelTransform
extends Transform
This abstract class represents a transformation methods that transforms probe-level signals, typically intensities.
Usage
ProbeLevelTransform(...)
Arguments
... |
Arguments passed to the constructor of |
Details
Subclasses must implement the process() method.
Fields and Methods
Methods:
No methods defined.
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The ProbeLevelTransform3 class
Description
Package: aroma.affymetrix
Class ProbeLevelTransform3
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
Directly known subclasses:
AbstractProbeSequenceNormalization, BaseCountNormalization, BasePositionNormalization, LinearModelProbeSequenceNormalization, MatNormalization, ScaleNormalization3, UnitTypeScaleNormalization
public abstract static class ProbeLevelTransform3
extends ProbeLevelTransform
This abstract class is specialized from ProbeLevelTransform and
provides methods to identify subsets and types of probes that are used
for fitting and/or updating the signals.
Usage
ProbeLevelTransform3(dataSet=NULL, ..., unitsToFit="-XY", typesToFit=typesToUpdate,
unitsToUpdate=NULL, typesToUpdate="pm", shift=0)
Arguments
dataSet |
|
... |
Arguments passed to the constructor of
|
unitsToFit |
The units from which the normalization curve should
be estimated. If |
typesToFit |
Types of probes to be used when fitting the model. |
unitsToUpdate |
The units to be updated.
If |
typesToUpdate |
Types of probes to be updated. |
shift |
An optional amount to shift data before fitting and updating. |
Fields and Methods
Methods:
No methods defined.
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The QualityAssessmentFile class
Description
Package: aroma.affymetrix
Class QualityAssessmentFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--QualityAssessmentFile
Directly known subclasses:
public abstract static class QualityAssessmentFile
extends AffymetrixCelFile
This class represents probe-level QC information (residuals, weights, etc.)
Usage
QualityAssessmentFile(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
findUnitsTodo | - |
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson
See Also
An object of this class is typically part of a QualityAssessmentSet.
The QualityAssessmentModel class
Description
Package: aroma.affymetrix
Class QualityAssessmentModel
Object
~~|
~~+--QualityAssessmentModel
Directly known subclasses:
public static class QualityAssessmentModel
extends Object
Usage
QualityAssessmentModel(plm=NULL, tags="*", ...)
Arguments
plm |
|
tags |
|
... |
Not used. |
Fields and Methods
Methods:
getChipEffectSet | - | |
getDataSet | - | |
getFullName | - | |
getName | - | |
getPath | - | |
getPlm | - | |
getResiduals | Calculates the residuals from a probe-level model. | |
getTags | - | |
getWeights | Calculates the weights from the robust fit to a probe-level model. | |
nbrOfArrays | - | |
plotNuse | - | |
plotRle | - |
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
The QualityAssessmentSet class
Description
Package: aroma.affymetrix
Class QualityAssessmentSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--QualityAssessmentSet
Directly known subclasses:
public static class QualityAssessmentSet
extends AffymetrixCelSet
Usage
QualityAssessmentSet(...)
Arguments
... |
Arguments passed to constructor of |
Fields and Methods
Methods:
No methods defined.
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson
The QuantileNormalization class
Description
Package: aroma.affymetrix
Class QuantileNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--QuantileNormalization
Directly known subclasses:
DChipQuantileNormalization
public static class QuantileNormalization
extends ProbeLevelTransform
This class represents a normalization function that transforms the probe-level signals towards the same empirical distribution.
Usage
QuantileNormalization(..., subsetToUpdate=NULL, typesToUpdate=NULL,
targetDistribution=NULL, subsetToAvg=subsetToUpdate, typesToAvg=typesToUpdate)
Arguments
... |
Arguments passed to the constructor of
|
subsetToUpdate |
The probes to be updated.
If |
typesToUpdate |
Types of probes to be updated. |
targetDistribution |
A |
subsetToAvg |
The probes to calculate average empirical
distribution over. If a single |
typesToAvg |
Types of probes to be used when calculating the
average empirical distribution.
If |
Fields and Methods
Methods:
process | Normalizes the data set. |
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Examples
## Not run:
for (zzz in 0) {
# Setup verbose output
verbose <- Arguments$getVerbose(-2)
timestampOn(verbose)
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Define an example dataset
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Find any dataset
path <- NULL
if (is.null(path))
break
ds <- AffymetrixCelSet$fromFiles(path)
print(ds)
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Normalization
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
norm <- QuantileNormalization(ds, subsetToAvg=1/3)
dsQN <- process(norm, verbose=verbose)
print(dsQN)
} # for (zzz in 0)
rm(zzz)
## End(Not run)
The ReseqCrosstalkCalibration class
Description
Package: aroma.affymetrix
Class ReseqCrosstalkCalibration
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ReseqCrosstalkCalibration
Directly known subclasses:
public static class ReseqCrosstalkCalibration
extends ProbeLevelTransform
This class represents a calibration function that transforms the probe-level signals such that the signals from the four nucleotides (A, C, G, T) are orthogonal.
Usage
ReseqCrosstalkCalibration(dataSet=NULL, ..., targetAvg=2200, subsetToAvg=NULL,
mergeGroups=FALSE, flavor=c("sfit", "expectile"), alpha=c(0.1, 0.075, 0.05, 0.03,
0.01), q=2, Q=98)
Arguments
dataSet |
An |
... |
Arguments passed to the constructor of
|
targetAvg |
The signal(s) that the average of the sum of the probe quartets should have after calibration. |
subsetToAvg |
The indices of the cells (taken as the intersect of
existing indices) used to calculate average in order to rescale to
the target average. If |
mergeGroups |
A |
flavor |
A |
alpha, q, Q |
Additional arguments passed to
|
Fields and Methods
Methods:
process | Calibrates the data set. |
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The ResidualFile class
Description
Package: aroma.affymetrix
Class ResidualFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ResidualFile
Directly known subclasses:
public abstract static class ResidualFile
extends ParameterCelFile
This class represents estimates of residuals in the probe-level models.
Usage
ResidualFile(..., probeModel=c("pm"))
Arguments
... |
Arguments passed to |
probeModel |
The specific type of model, e.g. |
Fields and Methods
Methods:
findUnitsTodo | - | |
getImage | - | |
readUnits | - | |
writeImage | - |
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
See Also
An object of this class is typically obtained through the
getResidualSet() method for the ProbeLevelModel class.
An object of this class is typically part of a ResidualSet.
The ResidualSet class
Description
Package: aroma.affymetrix
Class ResidualSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ResidualSet
Directly known subclasses:
public static class ResidualSet
extends ParametersInterface
This class represents probe-level residuals from probe-level models.
Usage
ResidualSet(..., probeModel=c("pm"))
Arguments
... |
Arguments passed to |
probeModel |
The specific type of model, e.g. |
Fields and Methods
Methods:
findUnitsTodo | - | |
getAverageFile | - | |
getCellIndices | - | |
readUnits | - |
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Ken Simpson, Henrik Bengtsson
See Also
An object of this class is typically obtained through the
getResidualSet() method for the ProbeLevelModel class.
The RmaBackgroundCorrection class
Description
Package: aroma.affymetrix
Class RmaBackgroundCorrection
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--BackgroundCorrection
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaBackgroundCorrection
Directly known subclasses:
public static class RmaBackgroundCorrection
extends BackgroundCorrection
This class represents the RMA background adjustment function.
Usage
RmaBackgroundCorrection(..., addJitter=FALSE, jitterSd=0.2, seed=6022007)
Arguments
... |
Arguments passed to the constructor of
|
addJitter |
If |
jitterSd |
Standard deviation of the jitter noise added. |
seed |
An (optional) |
Details
Internally bg.adjust is used to background correct the
probe signals. The default is to background correct PM signals only.
Fields and Methods
Methods:
process | Performs background correction. |
Methods inherited from BackgroundCorrection:
getParameters, process
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Jitter noise
The fitting algorithm of the RMA background correction model may not converge if there too many small and discrete signals. To overcome this problem, a small amount of noise may be added to the signals before fitting the model. This is an ad hoc solution that seems to work. However, add Gaussian noise may generate non-positive signals.
Author(s)
Ken Simpson, Henrik Bengtsson
The RmaCnPlm class
Description
Package: aroma.affymetrix
Class RmaCnPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaSnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--CnPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaCnPlm
Directly known subclasses:
public abstract static class RmaCnPlm
extends CnPlm
Usage
RmaCnPlm(..., combineAlleles=FALSE)
Arguments
... |
Arguments passed to |
combineAlleles |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from CnPlm:
getCellIndices, getChipEffectSet, getCombineAlleles, getParameters, getProbeAffinityFile, setCombineAlleles
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from RmaSnpPlm:
getAsteriskTags
Methods inherited from RmaPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, getRlmFitFunctions
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Model
TO DO.
Author(s)
Henrik Bengtsson
The RmaPlm class
Description
Package: aroma.affymetrix
Class RmaPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaPlm
Directly known subclasses:
ExonRmaPlm, HetLogAddCnPlm, HetLogAddPlm, HetLogAddSnpPlm, RmaCnPlm, RmaSnpPlm
public abstract static class RmaPlm
extends ProbeLevelModel
This class represents the log-additive model part of the Robust Multichip Analysis (RMA) method described in Irizarry et al (2003).
Usage
RmaPlm(..., flavor=c("affyPLM", "oligo"))
Arguments
... |
Arguments passed to |
flavor |
A |
Fields and Methods
Methods:
No methods defined.
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Model
For a single unit group, the log-additive model of RMA is:
log_2(y_{ik}) = \beta_i + \alpha_k + \varepsilon_{ik}
where \beta_i are the chip effects for arrays i=1,...,I,
and \alpha_k are the probe affinities for probes k=1,...,K.
The \varepsilon_{ik} are zero-mean noise with equal variance.
The model is constrained such that \sum_k{\alpha_k} = 0.
Note that all PLM classes must return parameters on the intensity scale.
For this class that means that \theta_i = 2^\beta_i and
\phi_k = 2^\alpha_k are returned.
Different flavors of model fitting
There are a few differ algorithms available for fitting the same
probe-level model. The default and recommended method
(flavor="affyPLM") uses the implementation in the
preprocessCore package which fits the model parameters robustly
using an M-estimator (the method used to be in affyPLM).
Alternatively, other model-fitting algorithms are available.
The algorithm (flavor="oligo") used by the oligo package,
which originates from the affy packages, fits the model using
median polish, which is a non-robust estimator. Note that this algorithm
does not constraint the probe-effect parameters to multiply to one on
the intensity scale. Since the internal function does not return these
estimates, we can neither rescale them.
Author(s)
Henrik Bengtsson, Ken Simpson
References
Irizarry et al. Summaries of Affymetrix GeneChip probe level data.
NAR, 2003, 31, e15.
The RmaSnpPlm class
Description
Package: aroma.affymetrix
Class RmaSnpPlm
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--MultiArrayUnitModel
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelModel
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpPlm
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--RmaSnpPlm
Directly known subclasses:
RmaCnPlm
public abstract static class RmaSnpPlm
extends SnpPlm
Usage
RmaSnpPlm(..., mergeStrands=FALSE)
Arguments
... |
Arguments passed to |
mergeStrands |
If |
Fields and Methods
Methods:
No methods defined.
Methods inherited from SnpPlm:
getCellIndices, getChipEffectSet, getMergeStrands, getParameters, getProbeAffinityFile, setMergeStrands
Methods inherited from RmaPlm:
getAsteriskTags, getCalculateResidualsFunction, getParameters, getRlmFitFunctions
Methods inherited from ProbeLevelModel:
calculateResidualSet, calculateWeights, fit, getAsteriskTags, getCalculateResidualsFunction, getChipEffectSet, getProbeAffinityFile, getResidualSet, getRootPath, getWeightsSet
Methods inherited from MultiArrayUnitModel:
getListOfPriors, setListOfPriors, validate
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The ScaleNormalization class
Description
Package: aroma.affymetrix
Class ScaleNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ScaleNormalization
Directly known subclasses:
public static class ScaleNormalization
extends ProbeLevelTransform
This class represents a normalization function that transforms the probe-level signals towards the same scale.
Usage
ScaleNormalization(dataSet=NULL, ..., targetAvg=4400, subsetToUpdate=NULL,
typesToUpdate=NULL, subsetToAvg="-XY", typesToAvg=typesToUpdate, shift=0)
Arguments
dataSet |
|
... |
Arguments passed to the constructor of
|
targetAvg |
A |
subsetToUpdate |
The probes to be updated.
If |
typesToUpdate |
Types of probes to be updated. |
subsetToAvg |
The probes to calculate average signal over.
If a single |
typesToAvg |
Types of probes to be used when calculating the
average signal.
If |
shift |
Optional amount of shift if data before fitting/normalizing. |
Fields and Methods
Methods:
process | Normalizes the data set. |
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The ScaleNormalization3 class
Description
Package: aroma.affymetrix
Class ScaleNormalization3
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ScaleNormalization3
Directly known subclasses:
public static class ScaleNormalization3
extends ProbeLevelTransform3
This class represents a normalization function that transforms the probe-level signals towards the same scale.
Usage
ScaleNormalization3(..., targetAvg=4400)
Arguments
... |
Arguments passed to the constructor of
|
targetAvg |
A |
Fields and Methods
Methods:
process | Normalizes the data set. |
Methods inherited from ProbeLevelTransform3:
getAsteriskTags, getCellsTo, getCellsToFit, getCellsToUpdate, getParameters, getUnitsTo, getUnitsToFit, getUnitsToUpdate, writeSignals
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The SingleArrayUnitModel class
Description
Package: aroma.affymetrix
Class SingleArrayUnitModel
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--SingleArrayUnitModel
Directly known subclasses:
public abstract static class SingleArrayUnitModel
extends UnitModel
This abstract class represents a unit model that fits one model per unit based on signals from a single arrays. The nature of a single-array unit model is that each array can be fitted independently of the others.
Usage
SingleArrayUnitModel(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
fit | Estimates the model parameters. |
Methods inherited from UnitModel:
findUnitsTodo, getAsteriskTags, getFitSingleCellUnitFunction, getParameters
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Static method to get the low-level function that fits the PLM
Description
Static method to get the low-level function that fits the PLM.
Any subclass model must provide this method, which should return
a function that accepts a numeric vector of length K, where K
is the number of probes.
Usage
## Static method (use this):
## SingleArrayUnitModel$getFitUnitGroupFunction()
## Don't use the below:
## S3 method for class 'SingleArrayUnitModel'
getFitUnitGroupFunction(...)
Arguments
... |
Not used. |
Value
Returns a function.
See Also
For more information see SingleArrayUnitModel.
The SmoothMultiarrayModel class
Description
Package: aroma.affymetrix
Class SmoothMultiarrayModel
Object
~~|
~~+--ChromosomalModel
~~~~~~~|
~~~~~~~+--SmoothMultiarrayModel
Directly known subclasses:
SmoothRmaModel, SmoothSaModel
public abstract static class SmoothMultiarrayModel
extends ChromosomalModel
This abstract class represents a chromosomal smoothing method done chromosome by chromosome.
Usage
SmoothMultiarrayModel(..., typoOfWeights=c("none", "1/s2"), bandwidth=10000, tags="*")
Arguments
... |
Arguments passed to the constructor of |
typoOfWeights |
A |
bandwidth |
A single |
tags |
Fields and Methods
Methods:
getBandwidth | - | |
getOutputTuple | - | |
setBandwidth | - |
Methods inherited from ChromosomalModel:
as.character, fit, getAlias, getAromaGenomeTextFile, getAsteriskTags, getChipType, getChipTypes, getChromosomes, getFullName, getFullNames, getGenome, getGenomeData, getGenomeFile, getListOfAromaUgpFiles, getName, getNames, getParentPath, getPath, getReportPath, getRootPath, getSetTuple, getSets, getTags, indexOf, nbrOfArrays, nbrOfChipTypes, setChromosomes, setGenome, getListOfGenomeInformations, getPcuTheta, getPositionChipTypeUnit
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
The SmoothRmaModel class
Description
Package: aroma.affymetrix
Class SmoothRmaModel
Object
~~|
~~+--ChromosomalModel
~~~~~~~|
~~~~~~~+--SmoothMultiarrayModel
~~~~~~~~~~~~|
~~~~~~~~~~~~+--SmoothRmaModel
Directly known subclasses:
public abstract static class SmoothRmaModel
extends SmoothMultiarrayModel
This class represents the Chromosomal Smoothing Robust Multichip Analysis method.
Usage
SmoothRmaModel(...)
Arguments
... |
Arguments passed to the constructor of
|
Fields and Methods
Methods:
No methods defined.
Methods inherited from SmoothMultiarrayModel:
as.character, createOutputTuple, fitOneChromosome, getAsteriskTags, getBandwidth, getFitUnitGroupFunction, getOutputTuple, getRootPath, setBandwidth
Methods inherited from ChromosomalModel:
as.character, fit, getAlias, getAromaGenomeTextFile, getAsteriskTags, getChipType, getChipTypes, getChromosomes, getFullName, getFullNames, getGenome, getGenomeData, getGenomeFile, getListOfAromaUgpFiles, getName, getNames, getParentPath, getPath, getReportPath, getRootPath, getSetTuple, getSets, getTags, indexOf, nbrOfArrays, nbrOfChipTypes, setChromosomes, setGenome, getListOfGenomeInformations, getPcuTheta, getPositionChipTypeUnit
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The SnpChipEffectFile class
Description
Package: aroma.affymetrix
Class SnpChipEffectFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpChipEffectFile
Directly known subclasses:
CnChipEffectFile
public abstract static class SnpChipEffectFile
extends ChipEffectFile
This class represents estimates of chip effects in the probe-level models.
Usage
SnpChipEffectFile(..., mergeStrands=FALSE)
Arguments
... |
Arguments passed to |
mergeStrands |
Specifies if the strands are merged or not for these estimates. |
Fields and Methods
Methods:
extractTheta | - | |
extractTotalAndFracB | - | |
readUnits | - |
Methods inherited from ChipEffectFile:
as.character, extractChromosomalDataFrame, extractMatrix, extractTheta, findUnitsTodo, getAM, getAsFullCelFile, getCellIndices, getCellMapForMainCdf, getExpandedCellMap, getParameters, getUnitGroupCellArrayMap, getUnitGroupCellMatrixMap, getXAM, mergeGroups, readUnits, writeAsFullCelFile
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
See Also
An object of this class is typically part of a SnpChipEffectSet.
The SnpChipEffectGroupMerge class
Description
Package: aroma.affymetrix
Class SnpChipEffectGroupMerge
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ChipEffectTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectGroupMerge
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpChipEffectGroupMerge
Directly known subclasses:
public static class SnpChipEffectGroupMerge
extends ChipEffectGroupMerge
This class represents a method that merges SNP chip effects across groups unit by unit.
Usage
SnpChipEffectGroupMerge(..., mergeStrands=FALSE, mean=c("arithmetic", "geometric"))
Arguments
... |
Arguments passed to the constructor of
|
mergeStrands |
If |
mean |
A |
Fields and Methods
Methods:
getMergeFunction | - |
Methods inherited from ChipEffectGroupMerge:
getCdf, getMergeFunction, getParameters, process, setMergeFunction
Methods inherited from ChipEffectTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The SnpChipEffectSet class
Description
Package: aroma.affymetrix
Class SnpChipEffectSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ChipEffectSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpChipEffectSet
Directly known subclasses:
CnChipEffectSet
public static class SnpChipEffectSet
extends ChipEffectSet
This class represents estimates of chip effects in the probe-level models.
Usage
SnpChipEffectSet(..., mergeStrands="byFirstFile")
Arguments
... |
Arguments passed to |
mergeStrands |
Specifies if the strands are merged or not for these estimates. |
Fields and Methods
Methods:
extractAlleleSet | - | |
extractSnpCnvQSet | - | |
extractSnpQSet | - | |
extractTheta | - | |
extractTotalAndFreqB | - | |
getAverageFile | - | |
getMergeStrands | - | |
setMergeStrands | - |
Methods inherited from ChipEffectSet:
as.character, boxplotStats, byPath, calculateBaseline, calculateFieldBoxplotStats, calculateNuseBoxplotStats, calculateRleBoxplotStats, extractAffyBatch, extractChromosomalDataFrame, extractExpressionSet, extractMatrix, extractTheta, findByName, findUnitsTodo, fromDataSet, getAM, getAsFullCelSet, getAverageFile, getBaseline, getCellIndices, getXAM, plotBoxplot, readUnits, updateUnits
Methods inherited from ParameterCelSet:
extractDataFrame, extractMatrix
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The SnpInformation class
Description
Package: aroma.affymetrix
Class SnpInformation
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--SnpInformation
Directly known subclasses:
DChipSnpInformation, UflSnpInformation
public abstract static class SnpInformation
extends FileCacheKeyInterface
Usage
SnpInformation(...)
Arguments
... |
Arguments passed to |
Fields and Methods
Methods:
byChipType | Static method to define a genome information set by chip type. | |
getChipType | Gets the chip type of this genome information set. | |
getData | Gets all or a subset of the genome information data. | |
getFragmentLengths | - | |
getFragmentStarts | - | |
getFragmentStops | - | |
nbrOfEnzymes | - | |
nbrOfUnits | - | |
readDataFrame | - |
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Static method to define a genome information set from a CDF
Description
Static method to define a genome information set from a CDF.
Usage
## Static method (use this):
## SnpInformation$fromCdf(cdf, ...)
## Don't use the below:
## S3 method for class 'SnpInformation'
fromCdf(static, cdf, ...)
Arguments
cdf |
|
... |
Additional argument passed to |
Value
Returns a SnpInformation object.
See Also
*byChipType().
For more information see SnpInformation.
The SnpPlm interface class
Description
Package: aroma.affymetrix
Class SnpPlm
Interface
~~|
~~+--SnpPlm
Directly known subclasses:
AffineCnPlm, AffineSnpPlm, AvgCnPlm, AvgSnpPlm, CnPlm, HetLogAddCnPlm, HetLogAddSnpPlm, MbeiCnPlm, MbeiSnpPlm, RmaCnPlm, RmaSnpPlm
public class SnpPlm
extends Interface
An Interface implementing methods special for
ProbeLevelModels specific to SNP arrays.
Usage
SnpPlm(...)
Arguments
... |
Not used. |
Methods
Methods:
getCellIndices | - | |
getChipEffectSet | - | |
getMergeStrands | - | |
getProbeAffinityFile | - | |
setMergeStrands | - |
Methods inherited from Interface:
extend, print, uses
Requirements
Classes inheriting from this Interface must provide the
following fields:
- mergeStrands
A
logicalvalue indicating if strands should be merged or not.
Author(s)
Henrik Bengtsson
Examples
for (zzz in 0) {
# Setup verbose output
verbose <- Arguments$getVerbose(-2)
timestampOn(verbose)
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Define an example dataset using this path
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Find any SNP dataset
path <- NULL
if (is.null(path))
break
if (!exists("ds")) {
ds <- AffymetrixCelSet$fromFiles(path)
}
print(ds)
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Create a set of various PLMs for this dataset
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
if (!exists("models", mode="list")) {
mergeStrands <- TRUE
models <- list(
rma = RmaSnpPlm(ds, mergeStrands=mergeStrands),
mbei = MbeiSnpPlm(ds, mergeStrands=mergeStrands)
# affine = AffineSnpPlm(ds, background=FALSE, mergeStrands=mergeStrands)
)
}
print(models)
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# For each model, fit a few units
#
# Note, by fitting the same set of units across models, the internal
# caching mechanisms of aroma.affymetrix makes sure that the data is
# only read into memory once. See log for reading speed.
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
units <- 55+1:100
for (model in models) {
ruler(verbose)
fit(model, units=units, force=TRUE, verbose=verbose)
}
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# For each unit, plot the estimated (thetaB,thetaA) for all models
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# Should we plot the on the log scale?
log <- TRUE
# Do only user to press ENTER if more than one unit is plotted
opar <- par(ask=(length(units) > 1))
Alab <- expression(theta[A])
Blab <- expression(theta[B])
if (log) {
lim <- c(6, 16)
} else {
lim <- c(0, 2^15)
}
# For each unit...
for (unit in units) {
# For all models...
for (kk in seq_along(models)) {
ces <- getChipEffects(models[[kk]])
ceUnit <- ces[unit]
snpName <- names(ceUnit)[1]
theta <- ceUnit[[1]]
thetaA <- theta[[1]]$theta
thetaB <- theta[[2]]$theta
if (log) {
thetaA <- log(thetaA, base=2)
thetaB <- log(thetaB, base=2)
}
# Create the plot?
if (kk == 1) {
plot(NA, xlim=lim, ylim=lim, xlab=Blab, ylab=Alab, main=snpName)
abline(a=0, b=1, lty=2)
}
# Plot the estimated parameters
points(thetaB, thetaA, col=kk, pch=19)
}
} # for (unit ...)
# Reset graphical parameter settings
par(opar)
} # for (zzz in 0)
rm(zzz)
The SnpProbeAffinityFile class
Description
Package: aroma.affymetrix
Class SnpProbeAffinityFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ProbeAffinityFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--SnpProbeAffinityFile
Directly known subclasses:
CnProbeAffinityFile
public abstract static class SnpProbeAffinityFile
extends ProbeAffinityFile
This class represents estimates of probe affinities in SNP probe-level models.
Usage
SnpProbeAffinityFile(..., mergeStrands=FALSE)
Arguments
... |
Arguments passed to |
mergeStrands |
Specifies if the strands are merged or not for these estimates. |
Fields and Methods
Methods:
No methods defined.
Methods inherited from ProbeAffinityFile:
as.character, getCellIndices, getParameters, readUnits
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The SpatialReporter class
Description
Package: aroma.affymetrix
Class SpatialReporter
Object
~~|
~~+--GenericReporter
~~~~~~~|
~~~~~~~+--AffymetrixFileSetReporter
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AffymetrixCelSetReporter
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--SpatialReporter
Directly known subclasses:
public abstract static class SpatialReporter
extends AffymetrixCelSetReporter
A SpatialReporter generates image files of spatial representations of cell signals for each of the arrays in the input set.
Usage
SpatialReporter(..., reference=NULL)
Arguments
... |
Arguments passed to |
reference |
An optional reference |
Fields and Methods
Methods:
addColorMap | - | |
getColorMaps | - | |
plotMargins | - | |
process | Generates image files, scripts and dynamic pages for the explorer. | |
setColorMaps | - |
Methods inherited from AffymetrixCelSetReporter:
as.character, getChipType, getDataSet, getPath, nbrOfArrays
Methods inherited from AffymetrixFileSetReporter:
getFileSet, getInputName, getInputTags
Methods inherited from GenericReporter:
as.character, getAlias, getAsteriskTags, getFullName, getInputName, getInputTags, getMainPath, getName, getPath, getReportSet, getRootPath, getTags, process, setAlias, setup
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The TransformReport class
Description
Package: aroma.affymetrix
Class TransformReport
Object
~~|
~~+--TransformReport
Directly known subclasses:
public static class TransformReport
extends Object
Usage
TransformReport(inSet=NULL, outSet=NULL, ...)
Arguments
inSet |
The input data set as an |
outSet |
The output data set as an |
... |
Not used. |
Fields and Methods
Methods:
getCdf | - | |
getFullName | Gets the full name of the output data set. | |
getInputDataSet | Gets the source data set. | |
getName | Gets the name of the output data set. | |
getOutputDataSet | Gets the transformed data set. | |
getPath | Gets the path of the output data set. | |
getTags | Gets the tags of the output data set. | |
getUnitNamesFile | - | |
getUnitTypesFile | - | |
getYY | - | |
nbrOfArrays | - | |
plotXYCurve | - | |
plotXYCurveLog2 | - | |
seq | - | |
writeImageCombined | - | |
writeImages | - |
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The UgpGenomeInformation class
Description
Package: aroma.affymetrix
Class UgpGenomeInformation
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--GenomeInformation
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UgpGenomeInformation
Directly known subclasses:
public abstract static class UgpGenomeInformation
extends GenomeInformation
This class represents Aroma UGP genome information files.
Usage
UgpGenomeInformation(..., .ugp=NULL, .verify=TRUE)
Arguments
... |
Arguments passed to |
.ugp |
For internal use only. |
.verify |
For internal use only. |
Fields and Methods
Methods:
byChipType | Defines a UgpGenomeInformation object by chip type. | |
getChipType | - | |
getChromosomes | - | |
getData | - | |
getUnitsOnChromosome | - | |
isCompatibleWithCdf | - | |
nbrOfUnits | - | |
readDataFrame | - |
Methods inherited from GenomeInformation:
as.character, byChipType, fromCdf, fromDataSet, getChipType, getChromosomeStats, getChromosomes, getData, getPositions, getUnitIndices, getUnitsOnChromosome, getUnitsOnChromosomes, isCompatibleWithCdf, nbrOfUnits, plotDensity, readDataFrame, verify
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
Defines a UgpGenomeInformation object by chip type
Description
Defines a UgpGenomeInformation object by chip type.
Usage
## Static method (use this):
## UgpGenomeInformation$byChipType(chipType, tags=NULL, ..., nbrOfUnits=NULL,
## verbose=FALSE)
## Don't use the below:
## S3 method for class 'UgpGenomeInformation'
byChipType(static, chipType, tags=NULL, ..., nbrOfUnits=NULL, verbose=FALSE)
Arguments
chipType |
A |
tags |
... |
... |
Additional arguments passed to |
verbose |
See |
Value
Returns an UgpGenomeInformation object.
If no file was not found, an error is thrown.
See Also
For more information see UgpGenomeInformation.
The UnitModel class
Description
Package: aroma.affymetrix
Class UnitModel
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--Model
~~~~~~~~~~~~|
~~~~~~~~~~~~+--UnitModel
Directly known subclasses:
AffineCnPlm, AffinePlm, AffineSnpPlm, AlleleSummation, AvgCnPlm, AvgPlm, AvgSnpPlm, ExonRmaPlm, FirmaModel, HetLogAddCnPlm, HetLogAddPlm, HetLogAddSnpPlm, MbeiCnPlm, MbeiPlm, MbeiSnpPlm, MultiArrayUnitModel, ProbeLevelModel, RmaCnPlm, RmaPlm, RmaSnpPlm, SingleArrayUnitModel
public abstract static class UnitModel
extends Model
This class is abstract and represents a generic unit model, i.e. a model that is applied to each unit separately.
Usage
UnitModel(dataSet=NULL, probeModel=c("pm", "mm", "pm-mm", "min1(pm-mm)", "pm+mm"),
shift=0, ...)
Arguments
dataSet |
An |
probeModel |
A |
shift |
An optional amount the signals should be shifted (translated) before fitting the model. |
... |
Arguments passed to the constructor of |
Fields and Methods
Methods:
findUnitsTodo | Identifies non-fitted units. |
Methods inherited from Model:
as.character, fit, getAlias, getAsteriskTags, getDataSet, getFullName, getName, getPath, getRootPath, getTags, setAlias, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The UnitTypeScaleNormalization class
Description
Package: aroma.affymetrix
Class UnitTypeScaleNormalization
Object
~~|
~~+--ParametersInterface
~~~~~~~|
~~~~~~~+--AromaTransform
~~~~~~~~~~~~|
~~~~~~~~~~~~+--Transform
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--ProbeLevelTransform
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--ProbeLevelTransform3
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--UnitTypeScaleNormalization
Directly known subclasses:
public static class UnitTypeScaleNormalization
extends ProbeLevelTransform3
This class represents a normalization function that transforms the probe signals such that each unit type gets the same average.
Usage
UnitTypeScaleNormalization(..., targetAvg=4400)
Arguments
... |
Arguments passed to the constructor of
|
targetAvg |
A |
Fields and Methods
Methods:
process | Normalizes the data set. |
Methods inherited from ProbeLevelTransform3:
getAsteriskTags, getCellsTo, getCellsToFit, getCellsToUpdate, getParameters, getUnitsTo, getUnitsToFit, getUnitsToUpdate, writeSignals
Methods inherited from ProbeLevelTransform:
getRootPath
Methods inherited from Transform:
getOutputDataSet, getOutputFiles
Methods inherited from AromaTransform:
as.character, findFilesTodo, getAsteriskTags, getExpectedOutputFiles, getExpectedOutputFullnames, getFullName, getInputDataSet, getName, getOutputDataSet, getOutputDataSet0, getOutputFiles, getPath, getRootPath, getTags, isDone, process, setTags
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson
The WeightsFile class
Description
Package: aroma.affymetrix
Class WeightsFile
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFile
~~~~~~~~~~~~|
~~~~~~~~~~~~+--CacheKeyInterface
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--FileCacheKeyInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AromaMicroarrayDataFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParameterCelFile
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--WeightsFile
Directly known subclasses:
public abstract static class WeightsFile
extends ParameterCelFile
This class represents weights calculated from residuals of probe-level models.
Usage
WeightsFile(..., probeModel=c("pm"))
Arguments
... |
Arguments passed to |
probeModel |
The specific type of model, e.g. |
Fields and Methods
Methods:
findUnitsTodo | - | |
getImage | - | |
readUnits | - | |
writeImage | - |
Methods inherited from ParameterCelFile:
extractDataFrame, extractMatrix, readUnits
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelFile:
allocateFromCdf, as.character, clone, createFrom, extractMatrix, fromFile, getAm, getCdf, getExtensionPattern, getFileFormat, getImage, getUnitNamesFile, getUnitTypesFile, highlight, image270, nbrOfCells, plotDensity, plotImage, plotMvsA, plotMvsX, range, setCdf, smoothScatterMvsA, writeImage
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataFile:
getAttributeXY, getChipType, getPlatform, getPloidy, getXAM, hasAttributeXY, isAverageFile, setAttributeXY, setAttributesByTags
Methods inherited from FileCacheKeyInterface:
getCacheKey
Methods inherited from CacheKeyInterface:
getCacheKey
Methods inherited from GenericDataFile:
as.character, clone, compareChecksum, copyTo, equals, fromFile, getAttribute, getAttributes, getChecksum, getChecksumFile, getCreatedOn, getDefaultFullName, getExtension, getExtensionPattern, getFileSize, getFileType, getFilename, getFilenameExtension, getLastAccessedOn, getLastModifiedOn, getOutputExtension, getPath, getPathname, gunzip, gzip, hasBeenModified, is.na, isFile, isGzipped, linkTo, readChecksum, renameTo, renameToUpperCaseExt, setAttribute, setAttributes, setAttributesBy, setAttributesByTags, setExtensionPattern, testAttributes, validate, validateChecksum, writeChecksum, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson, Ken Simpson
See Also
An object of this class is typically obtained through the
getWeightsSet() method for the ProbeLevelModel class.
An object of this class is typically part of a WeightsSet.
The WeightsSet class
Description
Package: aroma.affymetrix
Class WeightsSet
Object
~~|
~~+--FullNameInterface
~~~~~~~|
~~~~~~~+--GenericDataFileSet
~~~~~~~~~~~~|
~~~~~~~~~~~~+--AromaMicroarrayDataSet
~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~+--AromaPlatformInterface
~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixFileSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~+--AffymetrixCelSet
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--ParametersInterface
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~+--WeightsSet
Directly known subclasses:
public static class WeightsSet
extends ParametersInterface
This class represents probe-level weights.
Usage
WeightsSet(..., probeModel=c("pm"))
Arguments
... |
Arguments passed to |
probeModel |
The specific type of model, e.g. |
Fields and Methods
Methods:
findUnitsTodo | - | |
getAverageFile | - | |
getCellIndices | - | |
readUnits | - |
Methods inherited from ParametersInterface:
getParameterSets, getParameters, getParametersAsString
Methods inherited from AffymetrixCelSet:
append, as, as.AffymetrixCelSet, as.character, averageQuantile, byName, byPath, clone, convertToUnique, doCRMAv1, doCRMAv2, doFIRMA, doGCRMA, doRMA, extractAffyBatch, extractFeatureSet, extractMatrix, extractSnpFeatureSet, findByName, getAverage, getAverageAsinh, getAverageFile, getAverageLog, getCdf, getChipType, getData, getIntensities, getPlatform, getTimestamps, getUnitGroupCellMap, getUnitIntensities, getUnitNamesFile, getUnitTypesFile, isDuplicated, justRMA, justSNPRMA, nbrOfArrays, normalizeQuantile, plotDensity, range, readUnits, setCdf, update2, writeSgr
Methods inherited from AffymetrixFileSet:
as, as.AffymetrixFileSet, byPath, getDefaultFullName
Methods inherited from AromaPlatformInterface:
getAromaPlatform, getAromaUflFile, getAromaUgpFile, getChipType, getPlatform, getUnitAnnotationDataFile, getUnitNamesFile, getUnitTypesFile, isCompatibleWith
Methods inherited from AromaMicroarrayDataSet:
as.AromaMicroarrayDataSetList, as.AromaMicroarrayDataSetTuple, getAromaFullNameTranslatorSet, getAverageFile, getChipType, getDefaultFullName, getPlatform, setAttributesBy, setAttributesBySampleAnnotationFile, setAttributesBySampleAnnotationSet, validate
Methods inherited from GenericDataFileSet:
[, [[, anyDuplicated, anyNA, append, appendFiles, appendFullNamesTranslator, appendFullNamesTranslatorByNULL, appendFullNamesTranslatorByTabularTextFile, appendFullNamesTranslatorByTabularTextFileSet, appendFullNamesTranslatorBydata.frame, appendFullNamesTranslatorByfunction, appendFullNamesTranslatorBylist, as.character, as.list, byName, byPath, c, clearCache, clearFullNamesTranslator, clone, copyTo, dsApplyInPairs, duplicated, equals, extract, findByName, findDuplicated, getChecksum, getChecksumFileSet, getChecksumObjects, getDefaultFullName, getFile, getFileClass, getFileSize, getFiles, getFullNames, getNames, getOneFile, getPath, getPathnames, getSubdirs, gunzip, gzip, hasFile, indexOf, is.na, names, nbrOfFiles, rep, resetFullNames, setFullNamesTranslator, sortBy, unique, update2, updateFullName, updateFullNames, validate, getFullNameTranslatorSet, getParentName
Methods inherited from FullNameInterface:
appendFullNameTranslator, appendFullNameTranslatorByNULL, appendFullNameTranslatorByTabularTextFile, appendFullNameTranslatorByTabularTextFileSet, appendFullNameTranslatorBycharacter, appendFullNameTranslatorBydata.frame, appendFullNameTranslatorByfunction, appendFullNameTranslatorBylist, clearFullNameTranslator, clearListOfFullNameTranslators, getDefaultFullName, getFullName, getFullNameTranslator, getListOfFullNameTranslators, getName, getTags, hasTag, hasTags, resetFullName, setFullName, setFullNameTranslator, setListOfFullNameTranslators, setName, setTags, updateFullName
Methods inherited from Object:
$, $<-, [[, [[<-, as.character, attach, attachLocally, clearCache, clearLookupCache, clone, detach, equals, extend, finalize, getEnvironment, getFieldModifier, getFieldModifiers, getFields, getInstantiationTime, getStaticInstance, hasField, hashCode, ll, load, names, objectSize, print, save, asThis
Author(s)
Henrik Bengtsson, Ken Simpson
See Also
An object of this class is typically obtained through the
getWeightsSet() method for the ProbeLevelModel class.
Coerce an object to an AffymetrixCelSet object
Description
Coerce an object to an AffymetrixCelSet object.
Usage
## S3 method for class 'AffymetrixCelSet'
as.AffymetrixCelSet(object, ...)
Arguments
... |
Other arguments passed to |
Value
Returns an AffymetrixCelSet object.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelSet.
Coerce an object to an AffymetrixCnChpSet object
Description
Coerce an object to an AffymetrixCnChpSet object.
Usage
## S3 method for class 'AffymetrixCnChpSet'
as.AffymetrixCnChpSet(object, ...)
Arguments
... |
Other arguments passed to |
Value
Returns an AffymetrixCnChpSet object.
See Also
For more information see AffymetrixCnChpSet.
Coerce an object to an AffymetrixFileSet object
Description
Coerce an object to an AffymetrixFileSet object.
Usage
## S3 method for class 'AffymetrixFileSet'
as.AffymetrixFileSet(object, ...)
Arguments
... |
Other arguments passed to |
Value
Returns an AffymetrixFileSet object.
See Also
For more information see AffymetrixFileSet.
Coerce an object to an CnagCfhSet object
Description
Coerce an object to an CnagCfhSet object.
Usage
## S3 method for class 'CnagCfhSet'
as.CnagCfhSet(object, ...)
Arguments
... |
Other arguments passed to |
Value
Returns an CnagCfhSet object.
See Also
For more information see CnagCfhSet.
Coerce an object to an DChipDcpSet object
Description
Coerce an object to an DChipDcpSet object.
Usage
## S3 method for class 'DChipDcpSet'
as.DChipDcpSet(object, ...)
Arguments
... |
Other arguments passed to |
Value
Returns an DChipDcpSet object.
See Also
For more information see DChipDcpSet.
Returns a short string describing the Affymetrix CEL set
Description
Returns a short string describing the Affymetrix CEL set.
Usage
## S3 method for class 'AffymetrixCelSet'
as.character(x, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelSet.
Returns a short string describing the set
Description
Returns a short string describing the set.
Usage
## S3 method for class 'AffymetrixCnChpSet'
as.character(x, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see AffymetrixCnChpSet.
Returns a short string describing the CNAG CFH set
Description
Returns a short string describing the CNAG CFH set.
Usage
## S3 method for class 'CnagCfhSet'
as.character(x, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see CnagCfhSet.
Returns a short string describing the DChip CHP set
Description
Returns a short string describing the DChip CHP set.
Usage
## S3 method for class 'DChipDcpSet'
as.character(x, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see DChipDcpSet.
Calculates the average empirical distribution across all samples
Description
Calculates the average empirical distribution across all samples.
Usage
## S3 method for class 'AffymetrixCelSet'
averageQuantile(this, probes=NULL, excludeCells=NULL, ..., verbose=FALSE)
Arguments
probes |
An optional |
... |
Not used. |
verbose |
See |
Details
This methods implements Step A2-A3 in the algorithm for quantile normalization proposed by Bengtsson et al. (2008).
Value
Returns a double vector of length N.
Missing values
If NAs are detected in a sample, these are excluded and the
approx() function (approx) is used to "expand"
the vector of the remaining values so that the sorted vector
(still) have length N.
Author(s)
Henrik Bengtsson
References
[1] H. Bengtsson, R. Irizarry, B. Carvalho, & T.P. Speed. Estimation and assessment of raw copy numbers at the single locus level, Bioinformatics, 2008.
See Also
averageQuantile.list
For more information see AffymetrixCelSet.
Creates a CDF from tiling-array BPMAP file
Description
Creates a CDF from tiling-array BPMAP file.
NOTE: This method applies only to Affymetrix tiling arrays! Furthermore, it is likely to be more useful for promoter tiling arrays and less so for whole-genome tiling arrays.
Usage
## Default S3 method:
bpmapCluster2Cdf(pathname, chipType, tags=NULL, rows, cols, maxProbeDistance=3000L,
minNbrOfProbes=30L, groupName=gsub("_.*", "", chipType), field="fullname",
stringRemove=sprintf("%s:.*;", groupName), ..., flavor=c("v2", "v1"), path="*",
verbose=-10)
Arguments
pathname |
The pathname to the BPMAP file. |
chipType, tags |
The chip type and optional tags of the CDF to be written. |
rows, cols |
Two positive |
maxProbeDistance |
A positive |
minNbrOfProbes |
A positive |
groupName |
A |
field |
A |
stringRemove |
An (optional) regular expression. |
... |
Optional arguments passed to |
flavor |
Specifying which version of BPMAP-to-CDF generator to use. The default is always to use the most recent one, which is also the recommended one. Previous versions are kept only for backward compatibility (and may be dropped at anytime). |
path |
The directory where the CDF file will be written.
If |
verbose |
See |
Details
This method applies only to Affymetrix tiling arrays. It is likely
to be useful for promoter tiling arrays and less so for whole-genome
tiling arrays.
Flavor "v2" replaced "v1" as aroma.affymetrix v2.5.4
(June 21, 2012). For details, see news(package="aroma.affymetrix").
Value
Returns (invisibly) a the pathname of the created CDF file. The created CDF is written to the current directory.
Author(s)
Henrik Bengtsson adopted from Mark Robinson standalone/online version as of July 11, 2011.
Defines a DChipGenomeInformation object by chip type
Description
Defines a DChipGenomeInformation object by chip type.
Usage
## S3 method for class 'DChipGenomeInformation'
byChipType(static, chipType, version=NULL, ..., verbose=FALSE)
Arguments
chipType |
A |
version |
An optional |
... |
Not used. |
verbose |
See |
Value
Returns an DChipGenomeInformation object.
If no file was not found, an error is thrown.
See Also
For more information see DChipGenomeInformation.
Defines a DChipSnpInformation object by chip type
Description
Defines a DChipSnpInformation object by chip type.
Usage
## S3 method for class 'DChipSnpInformation'
byChipType(static, chipType, version=NULL, ...)
Arguments
chipType |
A |
version |
An optional |
... |
Additional arguments passed to |
Value
Returns an DChipSnpInformation object.
If no file was not found, an error is thrown.
See Also
For more information see DChipSnpInformation.
Static method to define a genome information set by chip type
Description
Static method to define a genome information set by chip type.
Usage
## S3 method for class 'SnpInformation'
byChipType(...)
Arguments
... |
Not used. |
Value
Returns a SnpInformation object.
See Also
*fromCdf().
For more information see SnpInformation.
Estimates the baseline signal chromosome by chromosome
Description
Estimates the baseline signal chromosome by chromosome.
Usage
## S3 method for class 'ChipEffectSet'
calculateBaseline(this, chromosomes=NULL, ploidy=2, defaultPloidy=NA, all=FALSE,
force=FALSE, verbose=FALSE, ...)
Arguments
chromosomes |
An |
ploidy |
An |
defaultPloidy |
An |
all |
If |
force |
If |
verbose |
See |
... |
Not used. |
Author(s)
Henrik Bengtsson
See Also
getAverageFile.
For more information see ChipEffectSet.
Computes parameters for adjustment of specific binding
Description
Computes parameters for adjustment of specific binding.
Usage
## S3 method for class 'AffymetrixCelSet'
calculateParametersGsb(this, nbrOfPms=25000, affinities=NULL, seed=NULL, ...,
verbose=FALSE)
Arguments
nbrOfPms |
The number of random PMs to use in estimation. |
affinities |
|
seed |
An (optional) |
... |
Not used. |
verbose |
See |
Details
This method is not constant in memory! /HB 2007-03-26
Author(s)
Ken Simpson
Gets the set of residuals corresponding to the PLM
Description
Gets the set of residuals corresponding to the PLM.
Usage
## S3 method for class 'FirmaModel'
calculateResidualSet(this, ...)
Arguments
... |
Not used. |
Value
Returns a ResidualSet object.
See Also
For more information see FirmaModel.
Checks if two AffymetrixCdfFile objects are equal
Description
Checks if two AffymetrixCdfFile objects are equal.
Usage
## S3 method for class 'AffymetrixCdfFile'
compare(this, other, ...)
Arguments
other |
The other |
... |
Additional arguments passed to |
Value
Returns TRUE if the two objects are equal, otherwise FALSE.
See Also
For more information see AffymetrixCdfFile.
Calculates probe affinities from sequence
Description
Calculates probe affinities from sequence.
Adapted from compute.affinities in the gcrma package.
Attempts to find the tab-separated probe sequence file associated with
a particular CDF, and matches sequence to probe index in order to assign
an affinity to each probe.
Usage
## S3 method for class 'AffymetrixCdfFile'
computeAffinities(this, safe=TRUE, force=FALSE, verbose=FALSE, ...)
Arguments
safe |
A |
force |
If |
verbose |
See |
... |
Not used. |
Value
Returns a numeric vector of (log2) probe affinities, of length equal
to the total number of features on the array.
Author(s)
Ken Simpson, Henrik Bengtsson, Mark Robinson
Converts a CDF into the same CDF but with another format
Description
Converts a CDF into the same CDF but with another format.
Usage
## S3 method for class 'AffymetrixCdfFile'
convert(this, chipType=getChipType(this), suffix=NULL, sep="-", path="cdf", ...,
verbose=FALSE)
Arguments
chipType |
The chip type of the new CDF. |
suffix |
A suffix added to the chip type of the new CDF. |
sep |
A string separating the chip type and the suffix string. |
path |
The path where to store the new CDF file. |
... |
Additional arguments passed to |
verbose |
Value
Returns the new CDF as an AffymetrixCdfFile object.
See Also
To compare two CDFs, use equals().
Internally convertCdf is used.
For more information see AffymetrixCdfFile.
Gets and validates unit indices
Description
Gets and validates unit indices either by unit names or by a unit indices (validation).
Usage
## S3 method for class 'AffymetrixCdfFile'
convertUnits(this, units=NULL, keepNULL=FALSE, ...)
Arguments
units |
Either a |
keepNULL |
|
... |
Not used. |
Value
Returns an integer vector with unit indices.
If some units are non existing, an error is thrown.
See Also
For more information see AffymetrixCdfFile.
Creates an exon-by-transcript CDF
Description
Creates an exon-by-transcript CDF based on the probesets defined in an "exon-only" CDF and transcript-exon mapping of a NetAffx probeset annotation data file.
Usage
## S3 method for class 'AffymetrixCdfFile'
createExonByTranscriptCdf(cdf, csv, tags=c("*"), path=getPath(cdf),
type=c("all", "core", "extended", "full", "main", "control", "cds"), subsetBy=NULL,
within=NULL, ..., overwrite=FALSE, verbose=FALSE)
Arguments
cdf |
An |
csv |
An |
tags |
Additional tags added to the filename of created CDF, i.e. <chiptype>,<tags>.cdf. |
path |
The output path where the custom CDF will be written. |
type |
A |
subsetBy |
An optional |
within |
A |
... |
Additional arguments passed to |
overwrite |
If |
verbose |
... |
Value
Returns an AffymetrixCdfFile.
Requirements for the "exon-only" CDF
The template CDF - argument cdf - should be an "exon-only" CDF:
each unit has one group/probeset, which is the exon.
An example of this is the "unsupported" HuEx-1_0-st-v2.cdf
from Affymetrix, which has 1,432,154 units.
Such "exon-only" CDFs do not contain information about clustering
exons/probesets into gene transcripts.
The CDF may also contain a number of non-exon probesets corresponding
to control probes, which can contain very large numbers of
probes per probeset. Such units are dropped/ignored by this method.
Ordering of transcripts and exons within transcripts
The transcripts (=units) will be ordered as they appear in the NetAffx annotation file. Within each transcript (=unit), the exons (=groups) are ordered lexicographically by their names.
Naming of transcripts and exons
In the created CDF, each unit corresponds to one transcript cluster, and each group within a unit corresponds to the exons within that transcript cluster. Thus, the unit names correspond to the transcript cluster names and the group names correspond to the exon names.
The exon names are defined by unit names of the exon-only CDF,
whereas the transcript names are defined by the
transcriptClusterId column in the NetAffx annotation data file.
These transcript and exon names are often "non-sense" integers.
In order to map these to more genome-friendly names, use the various
annotations available in the NetAffx annotation data file.
Author(s)
Henrik Bengtsson adopted from createTranscriptCDF() written
by Ken Simpson, Elizabeth Purdom and Mark Robinson.
Examples
## Not run:
# The exon-only CDF
cdf <- AffymetrixCdfFile$byChipType("HuEx-1_0-st-v2")
# The NetAffx probeset annotation data file
csv <- AffymetrixNetAffxCsvFile("HuEx-1_0-st-v2.na24.hg18.probeset.csv", path=getPath(cdf))
# Create a CDF containing all core probesets:
cdfT <- createExonByTranscriptCdf(cdf, csv=csv, tags=c("*,HB20110911"))
print(cdfT)
# Create CDF containing the core probesets with 3 or 4 probes:
cdfT2 <- createExonByTranscriptCdf(cdf, csv=csv,
tags=c("*,bySize=3-4,HB20110911"),
subsetBy="probeCount", within=c("3", "4"))
print(cdfT2)
## End(Not run)
Creates a CEL file using another as a template
Description
Creates a CEL file using another as a template.
Usage
## S3 method for class 'AffymetrixCelFile'
createFrom(this, filename, path=NULL, overwrite=FALSE, skip=!overwrite,
version=c("4", "3"), methods=c("copy", "create"), clear=FALSE, defValue=0, ...,
verbose=FALSE)
Arguments
filename, path |
The filename and path of to the CEL file to be created. |
version |
The file-format version of the CEL file to be created. |
methods |
If |
clear |
If |
defValue |
A |
... |
Not used. |
verbose |
See "R.utils::Verbose". |
Value
Returns a AffymetrixCelFile reference to the new CEL file.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Creates a mono-cell version of the CDF
Description
Creates a mono-cell version of the CDF.
Usage
## S3 method for class 'AffymetrixCdfFile'
createMonocellCdf(this, chipType=getChipType(this), tags="monocell", path=NULL,
nbrOfCellsPerField=1, ..., ram=NULL, overwrite=FALSE, verbose=TRUE)
Arguments
chipType |
The chip type of the new CDF. |
tags |
Tags added to the chip type of the new CDF. |
path |
The path where to store the new CDF file. |
nbrOfCellsPerField |
Number of cells per group field the new CDF should have. |
... |
Additional arguments passed to |
ram |
A |
verbose |
Value
Returns the monocell CDF as an AffymetrixCdfFile object.
Author(s)
Henrik Bengtsson, Ken Simpson
See Also
For more information see AffymetrixCdfFile.
Creates a unique-cell version of the CDF
Description
In some cases, single probes map to multiple genome locations. In cases where you may later want to store a probe estimate (e.g. a probe effect or a residual), you will not be able to store more than one per cell. The unique CDF facilitates this by making the cell indices unique (essentially copying the multimapping probes).
Usage
## S3 method for class 'AffymetrixCdfFile'
createUniqueCdf(this, chipType=getChipType(this), tags="unique", path=NULL, units=NULL,
..., ram=NULL, verbose=TRUE)
Arguments
chipType |
The chip type of the new CDF. |
tags |
Tags added to the chip type of the new CDF. |
path |
The path where to store the new CDF file. |
... |
Additional arguments passed to |
ram |
A |
verbose |
Details
Note that the set of units in the "unique" CDF is identical to that of the input CDF. So are the unit groups in each unit. Also the number of cells per unit group is preserved. It is only the cell-index composition of each unit group that changes. The cell indices in the unique CDF are guaranteed to occur only once, whereas this may not be true for the input CDF.
Value
Returns the unique CDF as an AffymetrixCdfFile object.
Author(s)
Mark Robinson
See Also
For more information see AffymetrixCdfFile.
Estimation and assessment of raw copy numbers at the single locus level (CRMA v1)
Description
Estimation and assessment of raw copy numbers at the single locus level (CRMA v1) based on [1]. The algorithm is processed in bounded memory, meaning virtually any number of arrays can be analyzed on also very limited computer systems.
Usage
## S3 method for class 'AffymetrixCelSet'
doCRMAv1(csR, shift=+300, combineAlleles=TRUE, lengthRange=NULL, arrays=NULL, drop=TRUE,
verbose=FALSE, ...)
## Default S3 method:
doCRMAv1(dataSet, ..., verbose=FALSE)
## Default S3 method:
doASCRMAv1(...)
Arguments
csR, dataSet |
An |
shift |
An tuning parameter specifying how much to shift the probe signals before probe summarization. |
combineAlleles |
A |
lengthRange |
An optional |
arrays |
A |
drop |
If |
verbose |
See |
... |
Additional arguments used to set up |
Value
Returns a named list, iff drop == FALSE, otherwise
only ChipEffectSet object.
Allele-specific or only total-SNP signals
If you wish to obtain allele-specific estimates for SNPs, which
are needed to call genotypes or infer parent-specific copy numbers,
then use argument combineAlleles=FALSE. Total copy number
signals are still available.
If you know for certain that you will not use allele-specific
estimates, you will get slightly less noisy signals
(very small difference) if you use combineAlleles=TRUE.
doASCRMAv1(...) is a wrapper for
doCRMAv1(..., combineAlleles=FALSE).
Author(s)
Henrik Bengtsson
References
[1] H. Bengtsson, R. Irizarry, B. Carvalho & T.P. Speed.
Estimation and assessment of raw copy numbers at the
single locus level,
Bioinformatics, 2008.
See Also
For CRMA v2 (recommended by authors), which is a single-array
improvement over CRMA v1, see doCRMAv2().
A single-array preprocessing method for estimating full-resolution raw copy numbers from all Affymetrix genotyping arrays (CRMA v2)
Description
A single-array preprocessing method for estimating full-resolution raw copy numbers from all Affymetrix genotyping arrays (CRMA v2) based on [1]. The algorithm is processed in bounded memory, meaning virtually any number of arrays can be analyzed on also very limited computer systems.
We recommend CRMA v2 for estimating allele-specific as well total SNP signals from Affymetrix SNP chips.
Usage
## S3 method for class 'AffymetrixCelSet'
doCRMAv2(csR, combineAlleles=TRUE, lengthRange=NULL, arrays=NULL,
plm=c("AvgCnPlm", "RmaCnPlm"), drop=TRUE, verbose=FALSE, ...)
## Default S3 method:
doCRMAv2(dataSet, ..., verbose=FALSE)
## Default S3 method:
doASCRMAv2(...)
Arguments
csR, dataSet |
An |
combineAlleles |
A |
lengthRange |
An optional |
arrays |
A |
plm |
A |
drop |
If |
verbose |
See |
... |
Additional arguments used to set up |
Value
Returns a named list, iff drop == FALSE, otherwise
only ChipEffectSet object.
Allele-specific or only total-SNP signals
If you wish to obtain allele-specific estimates for SNPs, which
are needed to call genotypes or infer parent-specific copy numbers,
then use argument combineAlleles=FALSE. Total copy number
signals are still available.
If you know for certain that you will not use allele-specific
estimates, you will get slightly less noisy signals
(very small difference) if you use combineAlleles=TRUE.
doASCRMAv2(...) is a wrapper for
doCRMAv2(..., combineAlleles=FALSE).
Author(s)
Henrik Bengtsson
References
[1] H. Bengtsson, P. Wirapati & T.P. Speed.
A single-array preprocessing method for estimating
full-resolution raw copy numbers from all Affymetrix
genotyping arrays including GenomeWideSNP 5 & 6,
Bioinformatics, 2009.
See Also
For CRMA v1, which is a multi-array methods that precedes CRMA v2,
see doCRMAv1().
Finding Isoforms using Robust Multichip Analysis (FIRMA)
Description
Finding Isoforms using Robust Multichip Analysis (FIRMA) based on [1].
Usage
## S3 method for class 'AffymetrixCelSet'
doFIRMA(csR, ..., flavor=c("v1b", "v1a"), drop=TRUE, verbose=FALSE)
## Default S3 method:
doFIRMA(dataSet, ..., verbose=FALSE)
Arguments
csR, dataSet |
An |
... |
Additional arguments passed to |
flavor |
A |
drop |
If |
verbose |
See |
Value
Returns a named list, iff drop == FALSE, otherwise
only FirmaSet object (containing the FIRMA scores).
Using a custom exon-by-transcript CDF
It is strongly recommended to use a custom CDF, e.g. "core",
"extended" or "full" [1]. To use a custom CDF, set it before
calling this method, i.e. setCdf(csR, cdf).
Do not set the standard "non-supported" Affymetrix CDF
(see also Section 'Flavors').
Flavors
If flavor == "v1b" (default), then the standard
"non-supported" Affymetrix CDF is used for background correction
and the quantile normalization steps, and the custom CDF
is used for the probe summarization and everything that follows.
The advantage of this flavor is that those two first preprocessing
steps will remain the same if one later changes to a different
custom CDF.
If flavor == "v1a", then the custom CDF is used throughout
all steps of FIRMA, which means that if one changes the custom CDF
all steps will be redone.
Author(s)
Henrik Bengtsson
References
[1] E. Purdom, K. Simpson, M. Robinson, J. Conboy, A. Lapuk & T.P. Speed,
FIRMA: a method for detection of alternative splicing from
exon array data, Bioinformatics, 2008.
Robust Multichip Analysis (GCRMA)
Description
Robust Multichip Analysis (GCRMA) based on [1].
The algorithm is processed in bounded memory, meaning virtually
any number of arrays can be analyzed on also very limited computer
systems.
The method replicates the results of gcrma
(package gcrma) with great precision.
Usage
## S3 method for class 'AffymetrixCelSet'
doGCRMA(csR, arrays=NULL, type=c("fullmodel", "affinities"), uniquePlm=FALSE, drop=TRUE,
verbose=FALSE, ...)
## Default S3 method:
doGCRMA(dataSet, ..., verbose=FALSE)
Arguments
csR, dataSet |
An |
arrays |
A |
type |
A |
uniquePlm |
If |
drop |
If |
verbose |
See |
... |
Additional arguments used to set up |
Value
Returns a named list, iff drop == FALSE, otherwise
only ChipEffectSet object.
Author(s)
Henrik Bengtsson
References
[1] Z. Wu, R. Irizarry, R. Gentleman, F.M. Murillo & F. Spencer.
A Model Based Background Adjustment for Oligonucleotide
Expression Arrays, JASA, 2004.
Robust Multichip Analysis (RMA)
Description
Robust Multichip Analysis (RMA) based on [1].
The algorithm is processed in bounded memory, meaning virtually
any number of arrays can be analyzed on also very limited computer
systems.
The method replicates the results of fitPLM
(package affyPLM) with great precision.
Usage
## S3 method for class 'AffymetrixCelSet'
doRMA(csR, arrays=NULL, flavor=c("affyPLM", "oligo"), uniquePlm=FALSE, drop=TRUE,
verbose=FALSE, ...)
## Default S3 method:
doRMA(dataSet, ..., verbose=FALSE)
Arguments
csR, dataSet |
An |
arrays |
A |
flavor |
A character string specifying what model fitting algorithm to be used, cf. |
uniquePlm |
If |
drop |
If |
verbose |
See |
... |
Additional arguments used to set up |
Value
Returns a named list, iff drop == FALSE, otherwise
only ChipEffectSet object.
Author(s)
Henrik Bengtsson
References
[1] Irizarry et al.
Summaries of Affymetrix GeneChip probe level data.
NAR, 2003, 31, e15.
Extracts an in-memory AffyBatch object from the CEL set
Description
Extracts an in-memory AffyBatch object from the CEL set. Note that any modifications done to the extract object will not be reflected in the original CEL set.
Usage
## S3 method for class 'AffymetrixCelSet'
extractAffyBatch(this, ..., verbose=FALSE)
Arguments
... |
Argument passed to |
verbose |
See |
Details
Since the affy package is making use of special CDF environment packages, this method will warn if the needed package is missing and explain that affy will later try to download and install it automatically.
Value
Returns an AffyBatch-class object.
Author(s)
Henrik Bengtsson
See Also
Internally read.affybatch is used to read the data.
For more information see AffymetrixCelSet.
Extract data as a data.frame for a set of arrays
Description
Extract data as a data.frame for a set of arrays.
Usage
## S3 method for class 'ParameterCelSet'
extractDataFrame(this, addNames=FALSE, addUgcMap=TRUE, ..., drop=FALSE, verbose=FALSE)
Arguments
... |
Arguments passed to |
addNames |
If |
addUgcMap |
If |
verbose |
See |
Value
Returns a Jx(2+3+K) data.frame where J is the number of units,
and K is the number of arrays.
The first two columns, if addNames=TRUE, contains the
unit names and the group names.
The next three columns contains the (unit, group, cell) index map.
The last K columns named by the arrays contain the data for the K arrays.
No names are set for the rows.
The rows are ordered according to units arguments.
Author(s)
Henrik Bengtsson
See Also
*extractMatrix().
For more information see ParameterCelSet.
Extracts an in-memory ExpressionSet object
Description
Extracts an in-memory ExpressionSet object from a ChipEffectSet object.
Note that any modifications done to the extracted object will not
be reflected in the original chip-effect set.
Usage
## S3 method for class 'ChipEffectSet'
extractExpressionSet(this, ..., logBase=2, orderUnitsBy=c("asis", "lexicographic"),
annotationPkg=NULL, verbose=FALSE)
Arguments
... |
Optional argument passed to |
logBase |
An |
annotationPkg |
(optional) A |
verbose |
See |
Value
Returns an ExpressionSet-class object.
Author(s)
Henrik Bengtsson
See Also
For more information see ChipEffectSet.
Extracts CEL signals an in-memory FeatureSet object
Description
Extracts CEL signals an in-memory FeatureSet object from a AffymetrixCelSet object.
Note that any modifications done to the extracted object will not
be reflected in the original CEL set.
Usage
## S3 method for class 'AffymetrixCelSet'
extractFeatureSet(this, ..., verbose=FALSE)
Arguments
... |
Additional argument passed to |
verbose |
See |
Value
Returns an FeatureSet-class object.
Author(s)
Henrik Bengtsson
See Also
Internally read.celfiles is used to read the data.
To read summarized data as a ExpressionSet-class
object, see *extractExpressionSet().
For more information see AffymetrixCelSet.
Extract data as a matrix for a set of arrays
Description
Extract data as a matrix for a set of arrays.
Usage
## S3 method for class 'AffymetrixCelSet'
extractMatrix(this, cells=NULL, ..., field=c("intensities", "stdvs", "pixels"),
drop=FALSE, verbose=FALSE)
Arguments
cells |
(The subset of cells to be matched.
If |
... |
Not used. |
field |
The field to be extracted. |
drop |
If |
verbose |
See |
Value
Returns an JxK double matrix where J is the number of units,
and K is the number of arrays.
The names of the columns are the names of the arrays.
No names are set for the rows.
The rows are ordered according to cells argument.
Author(s)
Henrik Bengtsson, Mark Robinson
See Also
For more information see AffymetrixCelSet.
Extract data as a matrix for a set of arrays
Description
Extract data as a matrix for a set of arrays.
Usage
## S3 method for class 'ParameterCelSet'
extractMatrix(this, units=NULL, ..., field=c("intensities", "stdvs", "pixels"),
returnUgcMap=FALSE, drop=FALSE, verbose=FALSE)
Arguments
units |
(The subset of units to be matched.
If |
... |
Passed to |
field |
The field to be extracted. |
returnUgcMap |
If |
drop |
If |
verbose |
See |
Value
Returns an JxK double matrix where J is the number of units,
and K is the number of arrays.
The names of the columns are the names of the arrays.
No names are set for the rows.
The rows are ordered according to units arguments.
Author(s)
Henrik Bengtsson
See Also
*extractDataFrame().
For more information see ParameterCelSet.
Locates an annotation file by its chip type
Description
Locates an annotation file by its chip type.
Usage
## S3 method for class 'AromaChipTypeAnnotationFile'
findByChipType(...)
Arguments
... |
Additional arguments. |
Value
Returns the pathname (as a character string) to the first annotation
chip type file found. If no one was found, NULL is returned.
See Also
*byChipType().
For more information see AromaChipTypeAnnotationFile.
Identifies non-fitted units
Description
Identifies non-fitted units.
Usage
## S3 method for class 'FirmaModel'
findUnitsTodo(this, ...)
Arguments
... |
Not used. |
Value
Returns an integer vector of unit indices.
See Also
Internally this methods calls the same method for the
ChipEffectSet class.
For more information see FirmaModel.
Identifies non-fitted units
Description
Identifies non-fitted units.
Usage
## S3 method for class 'ProbeLevelModel'
findUnitsTodo(this, verbose=FALSE, ...)
Arguments
verbose |
|
... |
Not used. |
Value
Returns an integer vector of unit indices.
See Also
Internally this methods calls the same method for the
ChipEffectSet class.
For more information see ProbeLevelModel.
Identifies non-fitted units
Description
Identifies non-fitted units.
Usage
## S3 method for class 'UnitModel'
findUnitsTodo(...)
Arguments
... |
Arguments specific to any subclass. |
Value
Returns an integer vector of unit indices.
See Also
For more information see UnitModel.
Estimates the model parameters
Description
Estimates the model parameters for all or a subset of the units.
Usage
## S3 method for class 'FirmaModel'
fit(this, units="remaining", ..., ram=NULL, force=FALSE, verbose=FALSE)
Arguments
units |
The units to be fitted.
If |
... |
Arguments passed to |
ram |
A |
force |
If |
verbose |
See |
Details
All estimates are stored to file.
The non-array specific parameter estimates together with standard deviation estimates and convergence information are stored in one file.
The parameter estimates specific to each array, typically "chip effects", are stored in array specific files.
Data set specific estimates [L = number of probes]: phi [L doubles] (probe affinities), sd(phi) [L doubles], isOutlier(phi) [L logicals]
Algorithm-specific results: iter [1 integer], convergence1 [1 logical], convergence2 [1 logical] dTheta [1 double] sd(eps) - [1 double] estimated standard deviation of the error term
Array-specific estimates [K = nbr of arrays]: theta [K doubles] (chip effects), sd(theta) [K doubles], isOutlier(theta) [K logicals]
For each array and each unit group, we store:
1 theta, 1 sd(theta), 1 isOutlier(theta), i.e. (float, float, bit)
=> For each array and each unit (with G_j groups), we store:
G_j theta, G_j sd(theta), G_j isOutlier(theta),
i.e. G_j*(float, float, bit).
For optimal access we store all thetas first, then all sd(theta) and the
all isOutlier(theta).
To keep track of the number of groups in each unit, we have to have a
(unit, ngroups) map. This can be obtained from getUnitNames() for the
AffymetrixCdfFile class.
Value
Returns an integer vector of indices of the units fitted,
or NULL if no units was (had to be) fitted.
See Also
For more information see FirmaModel.
Estimates the model parameters
Description
Estimates the model parameters.
Usage
## S3 method for class 'Model'
fit(...)
Arguments
... |
Arguments specific to any subclass. |
Value
Returns an integer vector specifying what units where fitted.
See Also
For more information see Model.
Estimates the model parameters
Description
Estimates the model parameters for all or a subset of the units.
Usage
## S3 method for class 'ProbeLevelModel'
fit(this, units="remaining", ..., force=FALSE, ram=NULL, verbose=FALSE)
Arguments
units |
The units to be fitted.
If |
... |
Arguments passed to |
force |
If |
ram |
A |
verbose |
See |
Details
All estimates are stored to file.
The non-array specific parameter estimates together with standard deviation estimates and convergence information are stored in one file.
The parameter estimates specific to each array, typically "chip effects", are stored in array specific files.
Data set specific estimates [L = number of probes]: phi [L doubles] (probe affinities), sd(phi) [L doubles], isOutlier(phi) [L logicals]
Algorithm-specific results: iter [1 integer], convergence1 [1 logical], convergence2 [1 logical] dTheta [1 double] sd(eps) - [1 double] estimated standard deviation of the error term
Array-specific estimates [K = nbr of arrays]: theta [K doubles] (chip effects), sd(theta) [K doubles], isOutlier(theta) [K logicals]
For each array and each unit group, we store:
1 theta, 1 sd(theta), 1 isOutlier(theta), i.e. (float, float, bit)
=> For each array and each unit (with G_j groups), we store:
G_j theta, G_j sd(theta), G_j isOutlier(theta),
i.e. G_j*(float, float, bit).
For optimal access we store all thetas first, then all sd(theta) and the
all isOutlier(theta).
To keep track of the number of groups in each unit, we have to have a
(unit, ngroups) map. This can be obtained from getUnitNames() for the
AffymetrixCdfFile class.
Value
Returns an integer vector of indices of the units fitted,
or NULL if no units was (had to be) fitted.
Author(s)
Henrik Bengtsson
See Also
For more information see ProbeLevelModel.
Estimates the model parameters
Description
Estimates the model parameters for all or a subset of the units.
Usage
## S3 method for class 'SingleArrayUnitModel'
fit(this, arrays=NULL, units="remaining", ..., force=FALSE, verbose=FALSE)
Arguments
arrays |
The arrays to be fitted.
If |
units |
The units to be fitted.
If |
... |
Arguments passed to |
force |
If |
verbose |
See |
Details
All estimates are stored to file.
The parameter estimates specific to each array, typically "chip effects", are stored in array specific files.
Array-specific estimates [K = nbr of arrays]: theta [K doubles] (chip effects), sd(theta) [K doubles], isOutlier(theta) [K logicals]
For each array and each unit group, we store:
1 theta, 1 sd(theta), 1 isOutlier(theta), i.e. (float, float, bit)
=> For each array and each unit (with G_j groups), we store:
G_j theta, G_j sd(theta), G_j isOutlier(theta),
i.e. G_j*(float, float, bit).
Value
Returns nothing.
Author(s)
Henrik Bengtsson
See Also
For more information see SingleArrayUnitModel.
Fits the model for one chromosome across samples
Description
Fits the model for one chromosome across samples.
Usage
## S3 method for class 'SmoothMultiarrayModel'
fit(this, chromosome, force=FALSE, ..., verbose=FALSE)
Arguments
chromosome |
An |
... |
Additional arguments passed down to the internal fit function. |
verbose |
See |
Author(s)
Henrik Bengtsson
See Also
For more information see SmoothMultiarrayModel.
Fits quantile normalization functions for the arrays in the data set
Description
Fits quantile normalization functions for the arrays in the data set.
Usage
## S3 method for class 'AffymetrixCelFile'
fitQuantileNormFcn(this, yTarget, subset=NULL, ..., spar=NULL, nknots=1024,
verbose=FALSE)
Arguments
yTarget |
The target probe signals. |
subset |
An optional |
spar, nknots |
Control parameters passed to
|
... |
Not used. |
verbose |
See |
Value
Returns a normalization function.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Gets the log-intensities and log-ratios of chip effects for two arrays
Description
Gets the log-intensities and log-ratios of chip effects for two arrays.
Usage
## S3 method for class 'ChipEffectFile'
getAM(this, other, units=NULL, ..., verbose=FALSE)
Arguments
other |
The second |
units |
(The subset of units to be matched.
If |
... |
Not used. |
verbose |
See |
Value
Returns a Nx2 matrix where N is the number of units returned.
The names of the columns are A (log-intensities) and M (log-ratios).
The names of the rows are the unit indices (as indexed by the CDF).
The rows are ordered according to units arguments.
Author(s)
Henrik Bengtsson
See Also
*getXAM().
For more information see ChipEffectFile.
Gets the log-intensities and log-ratios of chip effects of the set relative to a reference chip effect file
Description
Gets the log-intensities and log-ratios of chip effects of the set relative to a reference chip effect file.
Usage
## S3 method for class 'ChipEffectSet'
getAM(this, other, units=NULL, ..., verbose=FALSE)
Arguments
other |
The second |
units |
(The subset of units to be matched.
If |
... |
Not used. |
verbose |
See |
Value
Returns an Jx2xK array where J is the number of units, and K is
the number of arrays (arrays are always the last dimension).
The names of the columns are A (log-intensities) and M (log-ratios).
The names of the rows are the unit indices (as indexed by the CDF).
The rows are ordered according to units arguments.
Author(s)
Henrik Bengtsson
See Also
For more information see ChipEffectSet.
Gets the alias of the report
Description
Gets the alias of the report.
Usage
## S3 method for class 'GenericReporter'
getAlias(this, ...)
Arguments
... |
Not used. |
Value
Returns a character, or NULL if no alias is set.
See Also
*setAlias().
*getName().
For more information see GenericReporter.
Gets the name alias for the model
Description
Gets the name alias for the model, if set.
Usage
## S3 method for class 'Model'
getAlias(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string, or NULL.
See Also
*getName()
*setAlias()
For more information see Model.
Gets the cell indices of allele pairs
Description
Gets the cell indices of allele pairs in units of type "genotyping" with 2 or 4 unit groups.
Usage
## S3 method for class 'AffymetrixCdfFile'
getAlleleCellPairs(this, units=NULL, stratifyBy=c("pm", "pmmm", "mm"), force=FALSE, ...,
verbose=FALSE)
Arguments
units |
A |
stratifyBy |
A |
... |
Not used. |
verbose |
Value
Returns a Nx2 integer matrix of cell indices, where each row is
a (PMA, PMB) probe pair.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Gets the indices of probepairs with the same pair of SNP nucleotides
Description
Gets the indices of probepairs with the same pair of SNP nucleotides. Note that the order of allele A and allele B is irrelevant. For instance, all probepairs with nucleotides (A,T) are calibrated together with all probepairs with nucleotides (T,A) reversed.
Usage
## S3 method for class 'AffymetrixCdfFile'
getAlleleProbePairs(this, units=NULL, ignoreOrder=TRUE, force=FALSE, verbose=FALSE, ...)
Arguments
verbose |
|
... |
Not used. |
Value
Returns a named list where each element is a two-column matrix where
the column names are the nucleotides for the two alleles.
Benchmarking
On an IBM Thinkpad A31 with 1.8GHz and 1GB RAM:
- Mapping10K_Xba142
10208 units & 432964 cells: 11 seconds.
- Mapping50K_Xba240
58960 SNPs & 589,600 (PMA,PMB) probe pairs: 11 seconds.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Gets the indices of probepairs with the same pair of SNP nucleotides
Description
Gets the indices of probepairs with the same pair of SNP nucleotides. Note that the order of allele A and allele B is irrelevant. For instance, all probepairs with nucleotides (A,T) are calibrated together with all probepairs with nucleotides (T,A) reversed.
Usage
## S3 method for class 'AffymetrixCdfFile'
getAlleleProbePairs3(this, units=NULL, ignoreOrder=TRUE, force=FALSE, ..., verbose=FALSE)
Arguments
verbose |
|
... |
Not used. |
Value
Returns a named list where each element is a two-column matrix where
the column names are the nucleotides for the two alleles.
Benchmarking
On an IBM Thinkpad A31 with 1.8GHz and 1GB RAM:
- Mapping10K_Xba142
10208 units & 432964 cells: 11 seconds.
- Mapping50K_Xba240
58960 SNPs & 589,600 (PMA,PMB) probe pairs: 11 seconds.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Calculates the mean and the standard deviation of the cell signal (intensity, standard deviation etc.) across the CEL set
Description
Calculates the mean and the standard deviation of the cell signal (intensity, standard deviation etc.) across the CEL set.
Usage
## S3 method for class 'AffymetrixCelSet'
getAverageFile(this, name=NULL, prefix="average", indices="remaining",
field=c("intensities", "stdvs"), mean=c("median", "mean"), sd=c("mad", "sd"),
na.rm=TRUE, g=NULL, h=NULL, ..., cellsPerChunk=moreCells * 10^7/length(this),
moreCells=1, force=FALSE, verbose=FALSE)
Arguments
name |
The label of the calculated parameters.
If |
indices |
An |
mean |
A |
sd |
A |
na.rm |
|
... |
Not used. |
cellsPerChunk |
A |
moreCells |
A |
force |
If |
verbose |
If |
Details
The parameter estimates are stored as a CEL file of the same class as
the data files in the set. The CEL file is named <name>.cel
and placed in the directory of the set.
Currently there is no specific data class for this file, but the average
cell signals are stored as "intensities", the standard deviation of the
cell signals as "stddevs", and the number of data points used for each
estimate is stored as "pixels".
Value
Returns an AffymetrixCelSet of the same class as the CEL set
averaged.
Author(s)
Henrik Bengtsson, Ken Simpson
See Also
For more information see AffymetrixCelSet.
Calculates the mean and the standard deviation of the cell signal (intensity, standard deviation etc.) across the CFH set
Description
Calculates the mean and the standard deviation of the cell signal (intensity, standard deviation etc.) across the CFH set.
Usage
## S3 method for class 'CnagCfhSet'
getAverageFile(this, name=NULL, prefix="average", indices="remaining",
field=c("intensities", "stdvs"), mean=c("median", "mean"), sd=c("mad", "sd"),
na.rm=TRUE, g=NULL, h=NULL, ..., cellsPerChunk=moreCells * 10^7/length(this),
moreCells=1, force=FALSE, verbose=FALSE)
Arguments
name |
The label of the calculated parameters.
If |
indices |
An |
mean |
A |
sd |
A |
na.rm |
|
... |
Not used. |
cellsPerChunk |
A |
moreCells |
A |
force |
If |
verbose |
If |
Details
The parameter estimates are stored as a CFH file of the same class as
the data files in the set. The CFH file is named <name>.cel
and placed in the directory of the set.
Currently there is no specific data class for this file, but the average
cell signals are stored as "intensities", the standard deviation of the
cell signals as "stddevs", and the number of data points used for each
estimate is stored as "pixels".
Value
Returns an CnagCfhSet of the same class as the CFH set
averaged.
See Also
For more information see CnagCfhSet.
Gets the baseline signals across chromosomes
Description
Gets the baseline signals across chromosomes.
Usage
## S3 method for class 'ChipEffectSet'
getBaseline(this, force=FALSE, verbose=FALSE, ...)
Arguments
force |
If |
verbose |
See |
... |
Not used. |
Author(s)
Henrik Bengtsson
See Also
For more information see ChipEffectSet.
Gets the CDF structure for this CEL file
Description
Gets the CDF structure for this CEL file.
Usage
## S3 method for class 'AffymetrixCelFile'
getCdf(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCdfFile object.
Author(s)
Henrik Bengtsson
See Also
*setCdf().
For more information see AffymetrixCelFile.
Gets the CDF structure for this CEL set
Description
Gets the CDF structure for this CEL set.
Usage
## S3 method for class 'AffymetrixCelSet'
getCdf(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCdfFile object.
Author(s)
Henrik Bengtsson
See Also
*setCdf().
For more information see AffymetrixCelSet.
Gets the CDF structure for this CEL file
Description
Gets the CDF structure for this CEL file.
Usage
## S3 method for class 'CnagCfhFile'
getCdf(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCdfFile object.
See Also
*setCdf().
For more information see CnagCfhFile.
Gets the CDF structure for this CFH set
Description
Gets the CDF structure for this CFH set.
Usage
## S3 method for class 'CnagCfhSet'
getCdf(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCdfFile object.
See Also
*setCdf().
For more information see CnagCfhSet.
Gets the CDF structure for this model
Description
Gets the CDF structure for this model.
Usage
## S3 method for class 'Model'
getCdf(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCdfFile object.
See Also
For more information see Model.
Gets the cell indices unit by unit
Description
Gets the cell indices unit by unit of all or a subset of the units.
Usage
## S3 method for class 'AffymetrixCdfFile'
getCellIndices(this, units=NULL, ..., useNames=TRUE, unlist=FALSE, force=FALSE,
cache=TRUE, verbose=FALSE)
Arguments
units |
The units of interest. If |
... |
Additional arguments passed to
|
useNames |
If |
unlist |
If |
force |
If |
cache |
If |
verbose |
Details
Note, that it is much more memory efficient to do
getCellIndices(cdf, useNames=FALSE, unlist=TRUE)
compare with unlist(getCellIndices(cdf), use.names=FALSE).
Value
Returns the list structure returned by
readCdfCellIndices.
See Also
See *setRestructor() to set a default re-constructor for
the returned CDF structure.
For more information see AffymetrixCdfFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'ChipEffectFile'
getCellIndices(this, ..., .cache=TRUE)
Arguments
... |
Additional arguments passed to |
.cache |
Ignored. |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see ChipEffectFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units.
Usage
## S3 method for class 'CnChipEffectFile'
getCellIndices(this, units=NULL, ..., unlist=FALSE, force=FALSE, .cache=TRUE,
verbose=FALSE)
Arguments
units |
Unit indices to be retrieved.
If |
... |
Additional arguments passed to |
unlist |
|
force |
If |
.cache |
(internal) If |
verbose |
See |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see CnChipEffectFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'CnProbeAffinityFile'
getCellIndices(this, ..., unlist=FALSE)
Arguments
... |
Additional arguments passed to |
unlist |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see CnProbeAffinityFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units.
Usage
## S3 method for class 'ExonChipEffectFile'
getCellIndices(this, ..., unlist=FALSE, force=FALSE, .cache=TRUE, verbose=FALSE)
Arguments
... |
Additional arguments passed to |
unlist |
|
force |
If |
.cache |
(internal) If |
verbose |
See |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
Author(s)
Henrik Bengtsson
See Also
For more information see ExonChipEffectFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'ExonProbeAffinityFile'
getCellIndices(this, ..., unlist=FALSE)
Arguments
... |
Additional arguments passed to |
unlist |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see ExonProbeAffinityFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'FirmaFile'
getCellIndices(this, ..., .cache=TRUE)
Arguments
... |
Additional arguments passed to |
.cache |
Ignored. |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see FirmaFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'ProbeAffinityFile'
getCellIndices(this, ..., verbose=FALSE)
Arguments
... |
Additional arguments passed to |
verbose |
See |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see ProbeAffinityFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'ResidualFile'
getCellIndices(this, ..., .cache=TRUE)
Arguments
... |
Additional arguments passed to |
.cache |
Ignored. |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see ResidualFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units.
Usage
## S3 method for class 'SnpChipEffectFile'
getCellIndices(this, units=NULL, ..., unlist=FALSE, force=FALSE, .cache=TRUE,
verbose=FALSE)
Arguments
units |
Unit indices to be retrieved.
If |
... |
Additional arguments passed to |
unlist |
|
force |
If |
.cache |
(internal) If |
verbose |
See |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see SnpChipEffectFile.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'SnpProbeAffinityFile'
getCellIndices(this, ..., unlist=FALSE)
Arguments
... |
Additional arguments passed to |
unlist |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see SnpProbeAffinityFile.
Gets the cell indices unit by unit
Description
Gets the cell indices unit by unit for all or a subset of units (probesets).
Usage
## S3 method for class 'UnitModel'
getCellIndices(this, ..., verbose=FALSE)
Arguments
... |
Additional arguments passed to |
verbose |
See |
Value
Returns the list structure consisting of CDF cell indices.
See Also
For more information see UnitModel.
Retrieves tree list of cell indices for a set of units
Description
Retrieves tree list of cell indices for a set of units from the associated CDF.
Usage
## S3 method for class 'WeightsFile'
getCellIndices(this, ..., .cache=TRUE)
Arguments
... |
Additional arguments passed to |
.cache |
Ignored. |
Value
Returns a list structure, where each element corresponds to a unit.
If argument unlist=TRUE is passed, an integer vector is returned.
See Also
For more information see WeightsFile.
Gets the set of chip effects for this model
Description
Gets the set of chip effects for this model. There is one chip-effect file per array.
Usage
## S3 method for class 'AlleleSummation'
getChipEffectSet(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
Value
Returns a ChipEffectSet object.
See Also
For more information see AlleleSummation.
Gets the set of chip effects for this model
Description
Gets the set of chip effects for this model. There is one chip-effect file per array.
Usage
## S3 method for class 'ProbeLevelModel'
getChipEffectSet(this, ..., verbose=FALSE)
Arguments
... |
Arguments passed to |
verbose |
Value
Returns a ChipEffectSet object.
See Also
For more information see ProbeLevelModel.
Gets the chip type for this CEL file
Description
Gets the chip type for this CEL file according to the AffymetrixCdfFile object.
Usage
## S3 method for class 'AffymetrixCelFile'
getChipType(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Gets the chip type for this CEL set
Description
Gets the chip type for this CEL set. The chip type is inferred from the current CDF.
Usage
## S3 method for class 'AffymetrixCelSet'
getChipType(this, ...)
Arguments
... |
Not used. |
Value
Returns an character string.
Author(s)
Henrik Bengtsson
See Also
*getCdf().
For more information see AffymetrixCelSet.
Gets the chip type for this CEL file
Description
Gets the chip type for this CEL file according to the AffymetrixCdfFile object.
Usage
## S3 method for class 'CnagCfhFile'
getChipType(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see CnagCfhFile.
Gets the chip type of this genome information set
Description
Gets the chip type of this genome information set.
Usage
## S3 method for class 'GenomeInformation'
getChipType(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see GenomeInformation.
Gets the chip type of this genome information set
Description
Gets the chip type of this genome information set.
Usage
## S3 method for class 'SnpInformation'
getChipType(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see SnpInformation.
Gets the names of the CN units
Description
Gets the names of the CN units.
Usage
## S3 method for class 'AffymetrixCdfFile'
getCnNames(this, ...)
Arguments
... |
Not used. |
Value
Author(s)
Henrik Bengtsson
See Also
*getSnpNames().
Internally, *getUnitTypes().
is used.
For more information see AffymetrixCdfFile.
Gets all or a subset of the genome information data
Description
Gets all or a subset of the genome information data.
Usage
## S3 method for class 'GenomeInformation'
getData(this, units=NULL, fields=c("chromosome", "physicalPosition"), orderBy=NULL, ...,
force=FALSE, verbose=FALSE)
Arguments
units |
The units for which the data should be returned. |
fields |
The fields to be returned. |
orderBy |
The fields by which the returned data frame should be ordered. |
... |
Named arguments used to select a subset of the units to be
returned. Either a value to be compared to or a |
Value
Returns a data.frame, where the row names correspond to unit indices
as defined by the annotation unit names file.
See Also
*getUnitIndices().
For more information see GenomeInformation.
Gets all or a subset of the genome information data
Description
Gets all or a subset of the genome information data.
Usage
## S3 method for class 'SnpInformation'
getData(this, units=NULL, fields=c("fragmentLength", "start", "stop"), orderBy=NULL, ...,
force=FALSE, verbose=FALSE)
Arguments
units |
The units for which the data should be returned. |
fields |
The fields to be returned. |
orderBy |
The fields by which the returned data frame should be ordered. |
... |
Named arguments used to select a subset of the units to be
returned. Either a value to be compared to or a |
Value
Returns a data.frame, where the row names correspond to unit indices
as defined by the CDF.
See Also
For more information see SnpInformation.
Gets the data set
Description
Gets the data set for which the reporter is generating output.
Usage
## S3 method for class 'AffymetrixCelSetReporter'
getDataSet(this, ...)
Arguments
... |
Not used. |
Value
Returns a AffymetrixCelSet.
See Also
For more information see AffymetrixCelSetReporter.
Gets the data set
Description
Gets the data set for which the explorer is displaying it results.
Usage
## S3 method for class 'ArrayExplorer'
getDataSet(this, ...)
Arguments
... |
Not used. |
Value
Returns a AffymetrixCelSet.
See Also
For more information see ArrayExplorer.
Gets the input data set for this model
Description
Gets the input data set for this model.
Usage
## S3 method for class 'Model'
getDataSet(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCelSet.
See Also
For more information see Model.
Gets the set of FIRMA results for this model
Description
Gets the set of FIRMA results for this model. There is one chip-effect file per array.
Usage
## S3 method for class 'FirmaModel'
getFirmaSet(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
Value
Returns a FirmaSet object.
See Also
For more information see FirmaModel.
Gets the low-level function that fits the PLM
Description
Gets the low-level function that fits the PLM.
Usage
## S3 method for class 'AffinePlm'
getFitUnitGroupFunction(this, ...)
Arguments
... |
Not used. |
Value
Returns a function.
Author(s)
Henrik Bengtsson
See Also
calibrateMultiscan.
For more information see AffinePlm.
Gets the low-level function that fits the PLM
Description
Gets the low-level function that fits the PLM.
Usage
## S3 method for class 'AvgPlm'
getFitUnitGroupFunction(this, ...)
Arguments
... |
Not used. |
Value
Returns a function.
See Also
For more information see AvgPlm.
Gets the low-level function that fits the Exon PLM
Description
Gets the low-level function that fits the Exon PLM.
Usage
## S3 method for class 'ExonRmaPlm'
getFitUnitGroupFunction(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
Value
Returns a function.
Author(s)
Henrik Bengtsson and Ken Simpson (WEHI) utilizing Ben Bolstad's preprocessCore package.
See Also
For more information see ExonRmaPlm.
Static method to get the low-level function that fits the PLM
Description
Static method to get the low-level function that fits the PLM.
Usage
## S3 method for class 'FirmaModel'
getFitUnitGroupFunction(this, ...)
Arguments
... |
Not used. |
Value
Returns a function.
See Also
For more information see FirmaModel.
Gets the low-level function that fits the PLM
Description
Gets the low-level function that fits the PLM.
Usage
## S3 method for class 'HetLogAddPlm'
getFitUnitGroupFunction(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
Value
Returns a function.
Author(s)
Henrik Bengtsson and Ken Simpson (WEHI) utilizing Ben Bolstad's preprocessCore package.
See Also
For more information see HetLogAddPlm.
Gets the low-level function that fits the PLM
Description
Gets the low-level function that fits the PLM.
Usage
## S3 method for class 'MbeiPlm'
getFitUnitGroupFunction(this, ...)
Arguments
... |
Not used. |
Value
Returns a function.
See Also
fit.li.wong.
For more information see MbeiPlm.
Gets the low-level function that fits the PLM
Description
Gets the low-level function that fits the PLM.
Usage
## S3 method for class 'RmaPlm'
getFitUnitGroupFunction(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
Value
Returns a function.
Author(s)
Henrik Bengtsson and Ken Simpson (WEHI) utilizing Ben Bolstad's preprocessCore package.
See Also
For more information see RmaPlm.
Gets the full name of the output set
Description
Gets the full name of the output set, which consists of the name with appended comma-separated tags.
Usage
## S3 method for class 'Model'
getFullName(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see Model.
Gets the full name of the output data set
Description
Gets the full name of the output data set, which is the name with comma separated tags.
Usage
## S3 method for class 'TransformReport'
getFullName(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see TransformReport.
Gets genome information for this chip type
Description
Gets genome information for this chip type.
Usage
## S3 method for class 'AffymetrixCdfFile'
getGenomeInformation(this, types=c("UGP", "dChip"), ..., force=FALSE, verbose=FALSE)
Arguments
types |
A |
... |
Not used. |
force |
If |
verbose |
Value
Returns a GenomeInformation object.
See Also
For more information see AffymetrixCdfFile.
Examples
## Not run:
for (zzz in 0) {
# Define a CDF for a SNP chip
if (!exists("cdf")) {
cdf <- AffymetrixCdfFile$fromChipType(".*Sty.*")
}
print(cdf)
# Get the genome information
gi <- getGenomeInformation(cdf)
print(gi)
# Get the units on chromosome X order position by default
# (First call will be slow be data is being cached)
units <- getUnitIndices(gi, chromosome="X")
nunits <- length(units)
cat(sprintf("Number of units on chromosome X: %d\n", nunits))
str(units)
# Plot the SNP density for this chromosome
plotDensity(gi, chromosome="X")
} # for (zzz in 0)
rm(zzz)
## End(Not run)
Gets the header of the CDF file
Description
Gets the header of the CDF file.
Usage
## S3 method for class 'AffymetrixCdfFile'
getHeader(this, ...)
Arguments
... |
Not used. |
Value
Returns a list structure as returned by readCdfHeader.
See Also
For more information see AffymetrixCdfFile.
Gets the header of the CEL file
Description
Gets the header of the CEL file.
Usage
## S3 method for class 'AffymetrixCelFile'
getHeader(this, ...)
Arguments
... |
Not used. |
Value
Returns a list structure as returned by readCelHeader.
If file does not exists, then NULL is returned.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Gets the header of the PGF file
Description
Gets the header of the PGF file.
Usage
## S3 method for class 'AffymetrixPgfFile'
getHeader(this, ...)
Arguments
... |
Not used. |
Value
Returns a list structure as returned by readPgfHeader.
See Also
For more information see AffymetrixPgfFile.
Gets the header of the annotation file
Description
Gets the header of the annotation file.
Usage
## S3 method for class 'AromaChipTypeAnnotationFile'
getHeader(...)
Arguments
... |
Not used. |
Value
Returns a list structure.
See Also
For more information see AromaChipTypeAnnotationFile.
Gets the header of the CEL file
Description
Gets the header of the CEL file.
Usage
## S3 method for class 'CnagCfhFile'
getHeader(this, ...)
Arguments
... |
Not used. |
Value
Returns a list structure as returned by readCelHeader.
See Also
For more information see CnagCfhFile.
Creates an RGB Image object from a CEL file
Description
Creates an RGB Image object from a CEL file.
Usage
## S3 method for class 'AffymetrixCelFile'
getImage(this, other=NULL, transforms=list(sqrt), xrange=c(0, Inf), yrange=xrange,
zrange=c(0, sqrt(2^16)), field=c("intensities", "stdvs", "pixels"), zoom=1, ...,
readRectFcn=NULL, verbose=FALSE)
Arguments
other |
An optional |
xrange, yrange |
|
field |
One of the CEL file fields, i.e. |
zoom |
A |
... |
Additional arguments passed to
|
readRectFcn |
A |
verbose |
Value
Returns an Image object as defined by the EBImage package.
If palette==NULL, the color code is Grayscale, otherwise
TrueColor.
Author(s)
Ken Simpson, Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Gets the source data set
Description
Gets the source data set that is to be (or has been) transformed.
Usage
## S3 method for class 'TransformReport'
getInputDataSet(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCelSet.
See Also
For more information see TransformReport.
Gets cell intensities from a set of cells and a set of arrays
Description
Gets cell intensities from a set of cells and a set of arrays.
Usage
## S3 method for class 'AffymetrixCelSet'
getIntensities(this, ...)
Arguments
... |
Passed to |
Value
Returns a numeric NxK matrix, where N is the number of
cells read, and K is the number of arrays in the data set.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelSet.
Gets the name of the explorer
Description
Gets the name of the explorer.
Usage
## S3 method for class 'GenericReporter'
getName(this, ...)
Arguments
... |
Not used. |
Details
If a name alias has not been set explicitly, the input name will be used.
Value
Returns a character string.
See Also
For more information see GenericReporter.
Gets the name of the output data set
Description
Gets the name of the output data set, which is the same as the name of the input data set, unless an alias is set.
Usage
## S3 method for class 'Model'
getName(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
*getAlias()
For more information see Model.
Gets the name of the output data set
Description
Gets the name of the output data set, which is the same as the input data set.
Usage
## S3 method for class 'TransformReport'
getName(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see TransformReport.
Gets the transformed data set
Description
Gets the transformed data set, if processed.
Usage
## S3 method for class 'Transform'
getOutputDataSet(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
See |
Value
Returns an AromaMicroarrayDataSet or NULL.
See Also
For more information see Transform.
Gets the transformed data set
Description
Gets the transformed data set, if processed.
Usage
## S3 method for class 'TransformReport'
getOutputDataSet(this, ...)
Arguments
... |
Not used. |
Value
Returns an AffymetrixCelSet.
See Also
For more information see TransformReport.
Gets the path of this model
Description
Gets the path of this model where the parameter files are located. The directory is created, if missing.
Usage
## S3 method for class 'Model'
getPath(this, ...)
Arguments
... |
Not used. |
Details
If the path does not exist, it is created.
Value
Returns a character string.
See Also
For more information see Model.
Gets the path of the output data set
Description
Gets the path of the output data set. If non-existing, then the directory is created.
Usage
## S3 method for class 'TransformReport'
getPath(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see TransformReport.
Gets the physical positions for a set of units
Description
Gets the physical positions for a set of units.
Usage
## S3 method for class 'GenomeInformation'
getPositions(this, ..., na.rm=FALSE)
Arguments
... |
Arguments passed to |
na.rm |
If |
Value
See Also
*getData().
*getUnitIndices().
For more information see GenomeInformation.
Gets the probe affinities for this model
Description
Gets the probe affinities for this model.
Usage
## S3 method for class 'ProbeLevelModel'
getProbeAffinityFile(this, ..., .class=ProbeAffinityFile)
Arguments
... |
Not used. |
.class |
A |
Value
Returns a ProbeAffinityFile object.
See Also
For more information see ProbeLevelModel.
Calculates the residuals from a probe-level model
Description
Calculates the residuals from a probe-level model.
Usage
## S3 method for class 'QualityAssessmentModel'
getResiduals(this, units=NULL, path=NULL, name="qcData", tags="*", ram=NULL, force=FALSE,
verbose=FALSE, ...)
Arguments
... |
Additional arguments passed |
Value
Returns an QualityAssessmentSet.
See Also
For more information see QualityAssessmentModel.
Gets the root path of this model
Description
Gets the root path of this model.
By default, this is the string "model" appended by the capitalized
name of the model class, e.g. "modelUnit".
Usage
## S3 method for class 'Model'
getRootPath(this, ...)
Arguments
... |
Not used. |
Value
Returns a character string.
See Also
For more information see Model.
Gets the names of the SNP units
Description
Gets the names of the SNP units.
Usage
## S3 method for class 'AffymetrixCdfFile'
getSnpNames(this, ...)
Arguments
... |
Not used. |
Value
Author(s)
Henrik Bengtsson
See Also
*getCnNames().
Internally, *getUnitTypes().
is used.
For more information see AffymetrixCdfFile.
Gets the tags of the reporter
Description
Gets the tags of the reporter, which are the input tags plus additional tags.
Usage
## S3 method for class 'GenericReporter'
getTags(this, collapse=NULL, ...)
Arguments
... |
Not used. |
Value
See Also
For more information see GenericReporter.
Gets the tags of the output data set
Description
Gets the tags of the output data set, which consists of the tags of the input data set followed by an additional set of tags added by the model.
Usage
## S3 method for class 'Model'
getTags(this, collapse=NULL, ...)
Arguments
collapse |
A |
... |
Not used. |
Value
See Also
*setTags()
For more information see Model.
Gets the tags of the output data set
Description
Gets the tags of the output data set, which equals the tags of the input data set plus the tags of this transformation.
Usage
## S3 method for class 'TransformReport'
getTags(this, collapse=NULL, ...)
Arguments
... |
Not used. |
Value
See Also
For more information see TransformReport.
Gets the timestamp in the CEL header
Description
Gets the timestamp in the CEL header.
Usage
## S3 method for class 'AffymetrixCelFile'
getTimestamp(this, format="%m/%d/%y %H:%M:%S", ...)
Arguments
format |
The default format string for parsing the time stamp. |
... |
Not used. |
Value
Returns a POSIXct object.
The parsed string containing the timestamp is returned as
attribute text.
Author(s)
Henrik Bengtsson
See Also
Internally, strptime() is used to parse the time stamp.
DateTimeClasses for more information on POSIXct.
For more information see AffymetrixCelFile.
Gets a (unit, group, cell) index map
Description
Gets a (unit, group, cell) index map.
Usage
## S3 method for class 'ChipEffectFile'
getUnitGroupCellMap(this, units=NULL, force=FALSE, ..., verbose=FALSE)
Arguments
units |
The units for which the map should be returned.
If |
force |
If |
... |
Not used. |
verbose |
See |
Value
Returns a data.frame with integer columns unit, group,
and cell.
See Also
For more information see ChipEffectFile.
Examples
## Not run:
unit group cell
1 104 1 335
2 104 2 336
3 105 1 337
4 105 2 338
5 105 3 339
6 105 4 340
## End(Not run)
Gets unit indices ordered along the chromosome
Description
Gets unit indices ordered along the chromosome.
Usage
## S3 method for class 'GenomeInformation'
getUnitIndices(this, ..., na.rm=TRUE)
Arguments
... |
Arguments passed to |
na.rm |
If |
Value
See Also
*getData().
For more information see GenomeInformation.
Gets cell signals for a subset of units and a subset of arrays
Description
Gets cell signals for a subset of units and a subset of arrays.
Usage
## S3 method for class 'AffymetrixCelSet'
getUnitIntensities(this, units=NULL, ..., force=FALSE, cache=!is.null(units),
verbose=FALSE)
Arguments
units |
An |
... |
Arguments passed to the low-level function for reading
CEL units, i.e. |
force |
If |
verbose |
If |
Value
Returns a named list structure.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelSet.
Gets the names of each unit
Description
Gets the names of each unit.
Usage
## S3 method for class 'AffymetrixCdfFile'
getUnitNames(this, units=NULL, ...)
Arguments
units |
The units of interest. If |
... |
Not used. |
Details
Once read from file, this information is cached in memory for efficiency.
The cache can be cleared by calling gc(cdf).
Value
Returns a vector of character names.
See Also
For more information see AffymetrixCdfFile.
Gets the names of each unit
Description
Gets the names of each unit.
Usage
## S3 method for class 'AffymetrixPgfFile'
getUnitNames(this, units=NULL, ...)
Arguments
units |
The units of interest. If |
... |
Not used. |
Details
Once read from file, this information is cached in memory for efficiency.
The cache can be cleared by calling gc(pgf).
Value
Returns a vector of character names.
See Also
For more information see AffymetrixPgfFile.
Gets the types of a set of units
Description
Gets the types of a set of units.
Usage
## S3 method for class 'AffymetrixCdfFile'
getUnitTypes(this, units=NULL, ..., force=FALSE, .cache=TRUE, verbose=FALSE)
Arguments
units |
The units of interest. If |
... |
Not used. |
Details
Once read from file, this information is cached in memory for efficiency.
The cache can be cleared by calling gc(cdf).
Value
See Also
For more information see AffymetrixCdfFile.
Calculates the weights from the robust fit to a probe-level model
Description
Calculates the weights from the robust fit to a probe-level model.
Usage
## S3 method for class 'QualityAssessmentModel'
getWeights(this, path=NULL, name="qcData", tags="*", ..., ram=NULL, force=FALSE,
verbose=FALSE)
Arguments
path |
|
name |
|
tags |
|
... |
|
ram |
|
force |
|
verbose |
Value
Returns an QualityAssessmentSet.
See Also
For more information see QualityAssessmentModel.
Gets the physical position, log-intensities and log-ratios of chip effects for two arrays
Description
Gets the physical position, log-intensities and log-ratios of chip effects for two arrays of units on a certain chromosome.
Usage
## S3 method for class 'ChipEffectFile'
getXAM(this, other, chromosome, units=NULL, ..., verbose=FALSE)
Arguments
other |
The second |
chromosome |
(The chromosome for which results should be returned. |
units |
(The subset of units to be matched.
If |
... |
Not used. |
verbose |
See |
Value
Returns a Nx3 matrix where N is the number of units returned. The names of the columns are X (physical position in a given chromosome), A (log-intensities) and M (log-ratios). The names of the rows are the unit indices (as indexed by the CDF). Note: The rows are ordered according to chromosomal position.
Author(s)
Henrik Bengtsson
See Also
*getAM().
For more information see ChipEffectFile.
Gets the physical position, log-intensities and log-ratios of chip effects for two arrays
Description
Gets the physical position, log-intensities and log-ratios of chip effects for two arrays of units on a certain chromosome.
Usage
## S3 method for class 'ChipEffectSet'
getXAM(this, other, chromosome, units=NULL, ..., verbose=FALSE)
Arguments
other |
The second |
chromosome |
(The chromosome for which results should be returned. |
units |
(The subset of units to be matched.
If |
... |
Not used. |
verbose |
See |
Value
Returns a Nx3 matrix where N is the number of units returned. The names of the columns are X (physical position in a given chromosome), A (log-intensities) and M (log-ratios). The names of the rows are the unit indices (as indexed by the CDF). Note: The rows are ordered according to chromosomal position.
Author(s)
Henrik Bengtsson
See Also
*getAM().
For more information see ChipEffectSet.
Groups units by dimensions
Description
Groups units by dimensions.
Usage
## S3 method for class 'AffymetrixCdfFile'
groupUnitsByDimension(this, units=NULL, ..., sort=TRUE, verbose=FALSE)
Arguments
units |
An optional |
... |
Not used. |
sort |
If |
verbose |
Value
Returns a named list.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Displays all or a subset of the data spatially
Description
Displays all or a subset of the data spatially.
Usage
## S3 method for class 'AffymetrixCelFile'
image270(this, xrange=c(0, Inf), yrange=c(0, Inf), takeLog=TRUE, interleaved=FALSE, ...,
field=c("intensities", "stdvs", "pixels"), col=gray.colors(256), main=getName(this))
Arguments
xrange |
A |
yrange |
A |
... |
Additional arguments passed |
field |
The data field to be displayed. |
col |
The color map to be used. |
main |
The main title of the plot. |
Value
Returns the (270-degrees rotated) data matrix.
Author(s)
Henrik Bengtsson
See Also
*updateUnits().
For more information see AffymetrixCelFile.
Identifies duplicated CEL files
Description
Identifies duplicated CEL files by comparing the timestamps in the CEL headers.
Usage
## S3 method for class 'AffymetrixCelSet'
isDuplicated(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
If |
Value
Returns a logical vector of length equal to the number of files
in the set.
An element with value TRUE indicates that the corresponding CEL file
has the same time stamp as another preceeding CEL file.
Author(s)
Henrik Bengtsson
See Also
Internally duplicated() is used to compare timestamps.
For more information see AffymetrixCelSet.
Identifies duplicated CFH files
Description
Identifies duplicated CFH files by comparing the timestamps in the CFH headers.
Usage
## S3 method for class 'CnagCfhSet'
isDuplicated(this, ...)
Arguments
... |
Not used. |
Value
Returns a logical vector of length equal to the number of files
in the set.
An element with value TRUE indicates that the corresponding CFH file
has the same time stamp as another preceeding CFH file.
See Also
Internally duplicated() is used to compare timestamps.
For more information see CnagCfhSet.
Checks which cells (probes) are PMs and not
Description
Checks which cells (probes) are PMs and not.
Usage
## S3 method for class 'AffymetrixCdfFile'
isPm(this, units=NULL, force=FALSE, cache=TRUE, ..., verbose=FALSE)
Arguments
units |
The units to be read. If |
... |
Additional arguments passed to |
force |
If |
cache |
If |
verbose |
Value
Returns a logical vector of length K, where K equals the total number
of cells in the requested units. Note that the cells are ordered as
they occur in the units, that is, not in incremental order.
Caching
This method caches a logical vector of length N, when N equals the
number of cells on the array. The size of this vector is approximately
4*N bytes. The vector indicates if a cell is a PM or not.
See Also
For more information see AffymetrixCdfFile.
Static method to check if a CDF is for a resequencing (CustomSeq) chip
Description
Static method to check if a CDF is for a resequencing (CustomSeq) chip. Note, this method is not bullet proof. Several resequencing CDF does not carry that information. For such, we add tests based on their chip type, as we become aware of them.
Usage
## S3 method for class 'AffymetrixCdfFile'
isResequenceChip(this, ...)
Arguments
... |
Not used. |
Value
Returns TRUE if the chip type refers to a resequence array,
otherwise FALSE.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Static method to check if a chip is a mapping (SNP) chip
Description
Static method to check if a chip is a mapping (SNP) chip.
Usage
## S3 method for class 'AffymetrixCdfFile'
isSnpChip(this, ...)
Arguments
... |
Not used. |
Value
Returns TRUE if the chip type refers to a SNP array, otherwise FALSE.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Robust Multichip Analysis (RMA) reproducing the affy package
Description
Robust Multichip Analysis (RMA) reproducing the affy package as far as possible. The RMA method is described in [1].
The algorithm is processed in bounded memory, meaning a very large
number of arrays can be analyzed on also very limited computer systems.
The only limitation is the amount of memory required to load the final
chip-effect estimates into memory (as a ExpressionSet).
Usage
## S3 method for class 'AffymetrixCelSet'
justRMA(csR, flavor=c("oligo", "affyPLM"), ..., verbose=FALSE)
## Default S3 method:
justRMA(...)
Arguments
csR |
An |
flavor |
A |
... |
Additional arguments passed to |
verbose |
See |
Value
Returns an annotated ExpressionSet.
Reproducibility of affy
This implementation of the RMA method reproduces justRMA
in affy package quite well. It does so by still using a
constant memory profile, i.e. it is possible to use this implementation
to run RMA on a much large data set than what is possible with
affy. At least 20-50 times more samples should be
doable, if not more.
Author(s)
Henrik Bengtsson
References
[1] Irizarry et al.
Summaries of Affymetrix GeneChip probe level data.
NAR, 2003, 31, e15.
See Also
doRMA().
Gets the number of groups in each unit
Description
Gets the number of groups in each unit.
Usage
## S3 method for class 'AffymetrixCdfFile'
nbrOfGroupsPerUnit(this, units=NULL, ..., force=FALSE, verbose=FALSE)
Arguments
units |
The units of interest. If |
... |
Not used. |
verbose |
Details
Once read from file, this information is cached in memory for efficiency.
The cache can be cleared by calling gc(cdf).
Value
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Gets the number of SNPs
Description
Gets the number of SNPs.
Usage
## S3 method for class 'AffymetrixCdfFile'
nbrOfSnps(this, ...)
Arguments
... |
Additional arguments passed to |
Value
Returns an integer.
Author(s)
Henrik Bengtsson
See Also
Internally, *getSnpNames() is used to identify SNPs.
For more information see AffymetrixCdfFile.
Normalizes the probe intensities to a target empirical distribution
Description
Normalizes the probe intensities to a target empirical distribution.
Usage
## S3 method for class 'AffymetrixCelFile'
normalizeQuantile(this, path=file.path("normQuantile", getChipType(this)), xTarget,
subsetToUpdate=NULL, typesToUpdate=NULL, ..., overwrite=FALSE, skip=!overwrite,
verbose=FALSE)
Arguments
path |
The path where to save the normalized data files. |
xTarget |
A |
subsetToUpdate |
The indices of the probes to be updated.
If |
typesToUpdate |
Types of probes to be updated. For more details,
see argument |
... |
Additional arguments passed to |
overwrite |
If |
skip |
If |
verbose |
See |
Value
Returns the normalized AffymetrixCelFile object.
Author(s)
Henrik Bengtsson, Ken Simpson
See Also
normalizeQuantile
For more information see AffymetrixCelFile.
Normalizes samples to have the same empirical distribution
Description
Normalizes samples to have the same empirical distribution.
Usage
## S3 method for class 'AffymetrixCelSet'
normalizeQuantile(this, path=NULL, name="normQuantile", subsetToUpdate=NULL,
typesToUpdate=NULL, xTarget=NULL, subsetToAvg=subsetToUpdate, typesToAvg=typesToUpdate,
..., verbose=FALSE)
Arguments
path |
The path where to save the normalized data files.
If |
name |
The name of the normalized data set, which will also be part of the default path. |
subsetToUpdate |
The probes to be updated.
If |
typesToUpdate |
Types of probes to be updated. |
xTarget |
A |
subsetToAvg |
The probes to calculate average empirical
distribution over. If a single |
typesToAvg |
Types of probes to be used when calculating the
average empirical distribution.
If |
... |
Additional arguments passed to |
verbose |
See |
Value
Author(s)
Henrik Bengtsson
See Also
normalizeQuantileRank.numeric
For more information see AffymetrixCelSet.
Generates an Affymetrix CDF file from a Platform Design (PD) package and a auxiliary CEL file for the same chip type
Description
Generates an Affymetrix CDF file from a Platform Design (PD) package and a auxiliary CEL file for the same chip type. Platform Design (PD) packages are also known as "pdInfo" packages.
Disclaimer: This is a user-contributed function.
Instead of using this method, we recommend to use
writeCdf()
for the AffyGenePDInfo class.
Usage
pdInfo2Cdf(pdpkg, celfile, overwrite=FALSE, verbose=TRUE, ...)
Arguments
pdpkg |
A |
celfile |
The pathname to an auxiliary CEL for the same chip type. |
overwrite |
If |
verbose |
|
... |
Not used. |
Value
Returns (invisibly) the pathname to CDF written. The CDF filename is generated from the name of the PD package.
Limitations
The information available in the PD package is limited and does not contain all information needed to populate a CDF file. In order to workaround these limitations, certain CDF entries are set to predefined/hardwired values. The 'pbase' and 'tbase' entries of the generated CDF file is hardwired to "T" and "A", respectively. Likewise, the 'groupdirection' entry is hardwired to "sense".
Author(s)
Maintained by Mark Robinson. Original code by Samuel Wuest. Code improvements by Henrik Bengtsson.
See Also
Instead of using this method, we recommend to use
writeCdf()
for the AffyGenePDInfo class.
Plots a (merged or non-merged) list of boxplot.stats() elements
Description
Plots a (merged or non-merged) list of boxplot.stats() elements.
Usage
## S3 method for class 'list'
plotBoxplotStats(stats, ylim=NULL, outline=FALSE, las=2, ...)
Arguments
stats |
A (merged or non-merged) |
ylim, outline, las, ... |
Arguments passed to |
Value
Returns (invisibly) the merged boxplot.stats structure.
Author(s)
Elizabeth Purdom
Plots the density of the probe signals on the array
Description
Plots the density of the probe signals on the array.
Usage
## S3 method for class 'AffymetrixCelFile'
plotDensity(this, subset=NULL, types=NULL, ..., xlim=c(0, 16), xlab=NULL,
ylab="density (integrates to one)", log=TRUE, annotate=TRUE, verbose=FALSE)
Arguments
subset |
The subset of probes to considered before any
filtering by probe type is applied.
If a |
types |
The type of probes to include, e.g. |
... |
Additional arguments passed to
|
xlim |
The range on the x axis. |
xlab, ylab |
The labels on the x and the y axes. |
log |
If |
verbose |
Value
Returns nothing.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Plots the densities of all samples
Description
Plots the densities of all samples.
Usage
## S3 method for class 'AffymetrixCelSet'
plotDensity(this, subset=NULL, types=NULL, ..., col=seq_along(this), lty=NULL, lwd=NULL,
annotate=TRUE, add=FALSE, verbose=FALSE)
Arguments
subset |
The subset of probes to considered before any
filtering by probe type is applied.
If a |
types |
The type of probes to include, e.g. |
... |
Additional arguments passed to
|
col |
A |
lty |
A |
lwd |
A |
add |
If |
Value
Returns nothing.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelSet.
Plots the density of SNPs for a given chromosome
Description
Plots the density of SNPs for a given chromosome.
Usage
## S3 method for class 'GenomeInformation'
plotDensity(this, chromosome, ..., adjust=1/20, xlab=NULL, main=NULL, annotate=TRUE)
Arguments
chromosome |
The chromsome to be displayed. |
... |
Additional arguments passed to |
adjust |
A bandwidth parameter for the density estimator. |
xlab |
The label on the x-axis. If |
main |
The title of the plot. If |
annotate |
If |
Value
Returns (invisibly) the estimated density.
See Also
For more information see GenomeInformation.
Displays a spatial plot of a CEL file
Description
Displays a spatial plot of a CEL file.
Usage
## S3 method for class 'AffymetrixCelFile'
plotImage(this, ...)
Arguments
... |
Arguments passed to |
Value
Returns (invisibly) the image displayed.
Author(s)
Ken Simpson, Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Plots log-ratio versus log-intensity in a scatter plot
Description
Plots log-ratio versus log-intensity in a scatter plot.
Usage
## S3 method for class 'AffymetrixCelFile'
plotMvsA(this, reference, indices=NULL, pch=176, xlim=c(0, 16),
ylim=c(-1, 1) * diff(xlim), xlab=expression(A == 1/2 %*% log[2](y[1] * y[2])),
ylab=expression(M == log[2](y[1]/y[2])), ..., annotate=TRUE)
Arguments
reference |
The reference channel, i.e. the denominator in the log ratios. |
indices |
Indices of the probe signals to be plotted. |
pch |
The plot symbol. |
xlim, ylim |
The range of the x and the y axes. |
xlab, ylab |
The labels on the x and the y axes. |
... |
Additional arguments passed to |
annotate |
If |
Value
Returns (invisibly) a data.frame with the plotted data in the
first two columns.
Author(s)
Henrik Bengtsson
See Also
*smoothScatterMvsA().
*plotMvsX().
For more information see AffymetrixCelFile.
Plots log-ratio versus another variable in a scatter plot
Description
Plots log-ratio versus another variable in a scatter plot.
Usage
## S3 method for class 'AffymetrixCelFile'
plotMvsX(this, reference, x, indices=NULL, pch=176, ylim=c(-1, 1) * 2, ylab=NULL, ...,
what=c("M", "A"), add=FALSE, annotate=!add)
Arguments
reference |
The reference channel, i.e. the denominator in the log ratios. |
x |
|
indices |
Indices of the probe signals to be plotted. |
pch |
The plot symbol. |
ylim |
The range of the y axes. |
ylab |
The labels on the y axes. |
... |
Additional arguments passed to |
annotate |
If |
Value
Returns (invisibly) a data.frame with the plotted data in the
first two columns, and remaining data in the following columns.
Author(s)
Henrik Bengtsson
See Also
*plotMvsA().
*smoothScatterMvsA().
For more information see AffymetrixCelFile.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'AbstractProbeSequenceNormalization'
process(this, ..., ram=NULL, force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
ram |
A positive |
force |
If |
verbose |
See |
Value
Author(s)
Henrik Bengtsson
See Also
For more information see AbstractProbeSequenceNormalization.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'AdditiveCovariatesNormalization'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Additional arguments passed to
|
force |
If |
verbose |
See |
Value
Author(s)
Henrik Bengtsson
See Also
For more information see AdditiveCovariatesNormalization.
Calibrates the data set
Description
Calibrates the data set.
Usage
## S3 method for class 'AllelicCrosstalkCalibration'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see AllelicCrosstalkCalibration.
Generates image files, scripts and dynamic pages for the explorer
Description
Generates image files, scripts and dynamic pages for the explorer.
Usage
## S3 method for class 'ArrayExplorer'
process(this, arrays=NULL, ..., verbose=FALSE)
Arguments
arrays |
An optional |
... |
Not used. |
verbose |
Value
Returns nothing.
See Also
For more information see ArrayExplorer.
Processes the data set
Description
Processes the data set.
Usage
## S3 method for class 'BackgroundCorrection'
process(...)
Arguments
... |
Not used. |
Value
Author(s)
Henrik Bengtsson
See Also
For more information see BackgroundCorrection.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'ChipEffectGroupMerge'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see ChipEffectGroupMerge.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'DChipQuantileNormalization'
process(this, ..., force=FALSE, skip=TRUE, verbose=FALSE)
Arguments
... |
Arguments passed to
|
force |
If |
verbose |
See |
Value
See Also
For more information see DChipQuantileNormalization.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'FragmentEquivalentClassNormalization'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see FragmentEquivalentClassNormalization.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'FragmentLengthNormalization'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Additional arguments passed to
|
force |
If |
verbose |
See |
Value
See Also
For more information see FragmentLengthNormalization.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'GcContentNormalization'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see GcContentNormalization.
Performs background correction
Description
Performs background correction.
Usage
## S3 method for class 'GcRmaBackgroundCorrection'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
verbose |
See |
Value
Returns the output data set.
See Also
For more information see GcRmaBackgroundCorrection.
Generates report
Description
Generates report.
Usage
## S3 method for class 'GenericReporter'
process(...)
Arguments
... |
See subclasses. |
Value
Returns nothing.
See Also
For more information see GenericReporter.
Performs background correction
Description
Performs background correction.
Usage
## S3 method for class 'LimmaBackgroundCorrection'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
verbose |
See |
Value
See Also
For more information see LimmaBackgroundCorrection.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'MatNormalization'
process(this, ..., ram=NULL, force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see MatNormalization.
Processes the data set
Description
Processes the data set.
Usage
## S3 method for class 'MatSmoothing'
process(this, ..., units=NULL, force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see MatSmoothing.
Performs background correction
Description
Performs background correction.
Usage
## S3 method for class 'OpticalBackgroundCorrection'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
verbose |
See |
Value
Returns the output data set.
See Also
For more information see OpticalBackgroundCorrection.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'QuantileNormalization'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see QuantileNormalization.
Calibrates the data set
Description
Calibrates the data set.
Usage
## S3 method for class 'ReseqCrosstalkCalibration'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see ReseqCrosstalkCalibration.
Performs background correction
Description
Performs background correction.
Usage
## S3 method for class 'RmaBackgroundCorrection'
process(this, ..., force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
verbose |
See |
Value
Returns the output data set.
Author(s)
Henrik Bengtsson
See Also
For more information see RmaBackgroundCorrection.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'ScaleNormalization'
process(this, ..., skip=FALSE, force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see ScaleNormalization.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'ScaleNormalization3'
process(this, ..., skip=FALSE, force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see ScaleNormalization3.
Generates image files, scripts and dynamic pages for the explorer
Description
Generates image files, scripts and dynamic pages for the explorer.
Usage
## S3 method for class 'SpatialReporter'
process(this, ..., verbose=FALSE)
Arguments
... |
Not used. |
verbose |
Value
Returns nothing.
See Also
For more information see SpatialReporter.
Normalizes the data set
Description
Normalizes the data set.
Usage
## S3 method for class 'UnitTypeScaleNormalization'
process(this, ..., skip=FALSE, force=FALSE, verbose=FALSE)
Arguments
... |
Not used. |
force |
If |
verbose |
See |
Value
See Also
For more information see UnitTypeScaleNormalization.
Sets and resets the .Random.seed in the global environment
Description
Sets and resets the .Random.seed in the global environment.
Usage
randomSeed(action=c("set", "advance", "reset", "get"), seed=NULL, kind=NULL, backup=TRUE)
Arguments
action |
A |
seed |
Random seed to be set; only for |
kind |
(optional) A |
backup |
If |
Value
Returns a .Random.seed.
Author(s)
Henrik Bengtsson
Gets all or a subset of the fields in a CEL file
Description
Gets all or a subset of the fields in a CEL file for all or a subset of the cells.
Usage
## S3 method for class 'AffymetrixCelFile'
readRawData(this, indices=NULL, fields=c("xy", "intensities", "stdvs", "pixels"), ...,
drop=FALSE, verbose=FALSE)
Arguments
indices |
A |
fields |
Names of fields to be retrieved. |
... |
Additional arguments passed to |
drop |
If |
verbose |
Value
Returns a data.frame of the fields requested (unless dimension dropped).
Caching
Neither in-memory nor on-file caching is done by this method.
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Reads CDF data unit by unit
Description
Reads CDF data unit by unit for all or a subset of units (probeset).
Usage
## S3 method for class 'AffymetrixCdfFile'
readUnits(this, units=NULL, ..., verbose=FALSE)
Arguments
units |
The units to be read. If |
... |
Additional arguments passed to |
verbose |
Value
Returns the list structure that readCdfUnits returns
(possibly restructured).
Caching
CDF data is neither cached in memory nor on file by this method.
See Also
For more information see AffymetrixCdfFile.
Reads CEL data unit by unit
Description
Reads CEL data unit by unit for all or a subset of units (probeset).
Usage
## S3 method for class 'AffymetrixCelFile'
readUnits(this, units=NULL, cdf=NULL, ..., stratifyBy=NULL, force=FALSE, cache=FALSE,
verbose=FALSE)
Arguments
units |
The units to be read. If |
cdf |
An alternative CDF structure to be used. This overrides
the |
... |
Arguments passed to |
Value
Returns the list structure that readCelUnits returns.
Caching
CEL data is neither cached in memory nor on file by this method.
Author(s)
Henrik Bengtsson
See Also
*updateUnits().
For more information see AffymetrixCelFile.
Reads CEL data unit by unit
Description
Reads CEL data unit by unit for all or a subset of units (probeset).
Usage
## S3 method for class 'CnagCfhFile'
readUnits(this, units=NULL, ..., verbose=FALSE)
Arguments
units |
The units to be read. If |
... |
Arguments passed to |
Value
Returns the list structure that readCelUnits returns.
Caching
CEL data is neither cached in memory nor on file by this method.
See Also
For more information see CnagCfhFile.
Reads data unit by unit
Description
Reads data unit by unit for all or a subset of units (probeset) specially structured for this PLM.
Usage
## S3 method for class 'MultiArrayUnitModel'
readUnits(this, units=NULL, ..., verbose=FALSE)
Arguments
units |
The units to be read. If |
... |
Arguments passed to |
Value
Returns the list structure that readUnits() of
AffymetrixCelSet returns.
See Also
For more information see MultiArrayUnitModel.
Reads data unit by unit
Description
Reads data unit by unit for all or a subset of units (probeset) specially structured for this PLM.
Usage
## S3 method for class 'SingleArrayUnitModel'
readUnits(this, array, units=NULL, ..., verbose=FALSE)
Arguments
units |
The units to be read. If |
... |
Arguments passed to |
Value
Returns the list structure that readUnits() of
AffymetrixCelFile returns.
See Also
For more information see SingleArrayUnitModel.
Gets the cell quartets for each base position
Description
Gets the cell quartets for each base position.
Usage
## S3 method for class 'AffymetrixCdfFile'
readUnitsByQuartets(this, units=NULL, ..., verbose=FALSE)
Arguments
units |
Subset of units to be queried. If |
... |
Not used. |
Value
Author(s)
Henrik Bengtsson
See Also
For more information see AffymetrixCdfFile.
Sets the alias of the report
Description
Sets the alias of the report. If specified, the alias overrides the report name, which is used by default.
Usage
## S3 method for class 'GenericReporter'
setAlias(this, alias=NULL, ...)
Arguments
alias |
A |
... |
Not used. |
Value
Returns nothing.
See Also
*getAlias().
*getName().
For more information see GenericReporter.
Sets the name alias for the model
Description
Sets the name alias for the model, if set.
Usage
## S3 method for class 'Model'
setAlias(this, alias=NULL, ...)
Arguments
alias |
|
... |
Not used. |
Value
Returns nothing.
See Also
*getAlias()
For more information see Model.
Sets the arrays
Description
Sets the arrays to be processed by the explorer.
Usage
## S3 method for class 'ArrayExplorer'
setArrays(this, ...)
Arguments
... |
Not used. |
Value
See Also
For more information see ArrayExplorer.
Sets the CDF structure for this CEL file
Description
Sets the CDF structure for this CEL file.
Usage
## S3 method for class 'AffymetrixCelFile'
setCdf(this, cdf, ..., .checkArgs=TRUE)
Arguments
cdf |
An |
... |
Not used. |
.checkArgs |
(Internal) If |
Value
Returns nothing.
Author(s)
Henrik Bengtsson
See Also
*getCdf().
For more information see AffymetrixCelFile.
Sets the CDF structure for this CEL set
Description
Sets the CDF structure for this CEL set. This structures is assigned to all CEL files in the set.
Usage
## S3 method for class 'AffymetrixCelSet'
setCdf(this, cdf, verbose=FALSE, ..., .checkArgs=TRUE)
Arguments
cdf |
An |
verbose |
If |
... |
Not used. |
.checkArgs |
(Internal) If |
Value
Returns nothing.
Author(s)
Henrik Bengtsson
See Also
*getCdf().
For more information see AffymetrixCelSet.
Sets the CDF structure for this CEL file
Description
Sets the CDF structure for this CEL file.
Usage
## S3 method for class 'CnagCfhFile'
setCdf(this, cdf, ..., .checkArgs=TRUE)
Arguments
cdf |
An |
... |
Not used. |
Value
Returns nothing.
See Also
*getCdf().
For more information see CnagCfhFile.
Sets the CDF structure for this CFH set
Description
Sets the CDF structure for this CFH set. This structures is assigned to all CFH files in the set.
Usage
## S3 method for class 'CnagCfhSet'
setCdf(this, cdf, verbose=FALSE, ...)
Arguments
cdf |
An |
... |
Not used. |
Value
Returns nothing.
See Also
*getCdf().
For more information see CnagCfhSet.
Specifies a function through which
Description
Specifies a function through which of all or a subset of the units.
Usage
## S3 method for class 'AffymetrixCdfFile'
setRestructor(this, fcn=NULL, ...)
Arguments
... |
Additional arguments passed to
|
Value
Returns the list structure returned by
readCdfCellIndices.
Requirements
The reconstructor function have to:
Accept a
liststructure as its first argument.Require no other arguments.
Return a
liststructure of identical length as the input one. In other words, it must not change the number of units nor the order of units.
The reconstructor function may:
Rearrange the groups or change the number of groups, for instance by utilizing
applyCdfGroups.Exclude some cells, for instance by excluding MMs.
See Also
For more information see AffymetrixCdfFile.
Sets the tags to be appended
Description
Sets the tags to be appended to the tags of the input data set.
Usage
## S3 method for class 'Model'
setTags(this, tags=NULL, ...)
Arguments
tags |
A |
... |
Not used. |
Value
Returns nothing.
See Also
*getTags()
For more information see Model.
Setups example data in the current directory
Description
Setups example data in the current directory.
Usage
## S3 method for class 'AromaAffymetrix'
setupExampleData(pkg, dataset=NULL, chipType=NULL, dirs=c("annotationData", "rawData"),
mustWork=TRUE, validate=FALSE, ...)
Arguments
dataset, chipType |
|
dirs |
|
mustWork |
If |
validate |
If |
... |
Not used. |
Value
Returns (invisibly) TRUE if all requested data was installed,
otherwise FALSE.
Author(s)
Henrik Bengtsson
Plots log-ratio versus log-intensity in a smooth scatter plot
Description
Plots log-ratio versus log-intensity in a smooth scatter plot.
Usage
## S3 method for class 'AffymetrixCelFile'
smoothScatterMvsA(this, reference, indices=NULL, pch=176, xlim=c(0, 16),
ylim=c(-1, 1) * diff(xlim), xlab=expression(A == 1/2 %*% log[2](y[1] * y[2])),
ylab=expression(M == log[2](y[1]/y[2])), ..., annotate=TRUE)
Arguments
reference |
The reference channel, i.e. the denominator in the log ratios. |
indices |
Indices of the probe signals to be plotted. |
pch |
The plot symbol. |
xlim, ylim |
The range of the x and the y axes. |
xlab, ylab |
The labels on the x and the y axes. |
... |
Additional arguments passed to |
annotate |
If |
Value
Returns (invisibly) a data.frame with the plotted data in the
first two columns.
Author(s)
Henrik Bengtsson
See Also
*plotMvsA().
Internally smoothScatter is used.
For more information see AffymetrixCelFile.
Updates CEL data unit by unit
Description
Updates CEL data unit by unit for all or a subset of units.
Usage
## S3 method for class 'AffymetrixCelFile'
updateUnits(this, data, ...)
Arguments
data |
A |
... |
Not used. |
Value
Returns the list structure that updateCelUnits returns.
Author(s)
Henrik Bengtsson
See Also
*updateUnits().
For more information see AffymetrixCelFile.
Verifies the correctness of the underlying file
Description
Verifies the correctness of the underlying file.
Usage
## S3 method for class 'GenomeInformation'
verify(this, ...)
Arguments
... |
Not used. |
Value
Returns (visibly) TRUE if the file is valid, otherwise an error is
thrown.
See Also
For more information see GenomeInformation.
Verifies the correctness of the underlying file
Description
Verifies the correctness of the underlying file.
Usage
## S3 method for class 'SnpInformation'
verify(this, ...)
Arguments
... |
Not used. |
Value
Returns (visibly) TRUE if the file is valid, otherwise an error is
thrown.
See Also
For more information see SnpInformation.
Generates an Affymetrix CDF file from a Platform Design (PD) package
Description
Generates an Affymetrix CDF file from a Platform Design (PD) package. Platform Design (PD) packages are also known as "pdInfo" packages.
Usage
## S3 method for class 'AffyGenePDInfo'
writeCdf(this, tags=c("*"), unitsBy=c("transcript", "exon"), namesBy=c("fsetid", "id"),
path=NULL, overwrite=FALSE, verbose=TRUE, ...)
Arguments
tags |
An optional |
unitsBy |
A |
path |
The output path where the CDF file is written.
If |
overwrite |
If |
verbose |
|
... |
Not used. |
Details
The formal chip type of the CDF is inferred from the AffyGenePDInfo package. The filename of the CDF is constructed from the chip type and any optional tags. To minimize the risk for a corrupt CDF file, the creation of the file is atomic by first writing to a temporary file which is then renamed.
Value
Returns (invisibly) the pathname to CDF written.
Limitations
The information available in the PD package is limited and does not contain all information needed to populate a CDF file. In order to workaround these limitations, certain CDF entries are set to predefined/hardwired values. The 'pbase' and 'tbase' entries of the generated CDF file is hardwired to "T" and "A", respectively. Likewise, the 'groupdirection' entry is hardwired to "sense".
Author(s)
Henrik Bengtsson and Guido Hooiveld adopted from pdInfo2Cdf()
written by Samuel Wuest and Mark Robinson.
Writes a spatial image of the signals in the CEL file
Description
Writes a spatial image of the signals in the CEL file.
Usage
## S3 method for class 'AffymetrixCelFile'
writeImage(this, filename=NULL, fullname=NULL, tags=c("*", "sqrt", "gray"),
imgFormat="png", path=NULL, field=c("intensities", "stdvs", "pixels"), ..., skip=TRUE,
verbose=FALSE)
Arguments
filename |
A |
fullname |
A |
tags |
A |
imgFormat |
A |
path |
The path where the image file is stored. |
... |
Arguments passed to |
verbose |
Value
Returns the pathname to the image file created.
Author(s)
Ken Simpson, Henrik Bengtsson
See Also
For more information see AffymetrixCelFile.
Examples
## Not run:
yellow.colors <- function(n) { hsv(h=0.15, v=0:(n-1)/(n-1)) }
df <- ds[[1]]
writeImage(df, tags="gray", palette=gray.colors(256), xrange=c(0,200))
writeImage(df, tags="yellow", palette=yellow.colors(256), xrange=c(0,200))
writeImage(df, tags="heat", palette=heat.colors(256), xrange=c(0,200))
writeImage(df, tags="terrain", palette=terrain.colors(256), xrange=c(0,200))
writeImage(df, tags="topo", palette=topo.colors(256), xrange=c(0,200))
writeImage(df, tags="cm", palette=cm.colors(256), xrange=c(0,200))
writeImage(df, tags="rainbow", palette=rainbow(256), xrange=c(0,200))
## End(Not run)